Molecular Detection of OXA-type Carbapenemases among Acinetobacter baumannii Isolated from Burn Patients and Hospital Environments

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Molecular Detection of OXA-type Carbapenemases among Acinetobacter baumannii Isolated from Burn Patients and Hospital Environments

The Open Microbiology Journal • 20 Jul 2022 • RESEARCH ARTICLE • DOI: 10.2174/18742858-v16-e2206101

Abstract

Background:

Acinetobacter baumannii is known as one of the major causes of nosocomial infections, especially in intensive care units and burn patients. The emergence of antimicrobial resistance in burn wound bacterial pathogens is a severe health crisis. Detection of carbapenem resistance and genetic elements in A. baumannii associated with burn patients and hospital environments play a key role in the control and alerting in clinical settings.

Purpose:

In this study, the prevalence of OXA-type carbapenemases was investigated in A. baumannii strains isolated from burn patients and from a hospital environment in Tehran, 2021.

Methods:

A total of 85 non-duplicate A. baumannii isolates (53 from various surfaces of the hospital environment and 32 from burn patients) were recovered in the Burns Hospital in Tehran. The A. baumannii isolates were screened for antibiotic susceptibility and the presence of the most common OXA-type carbapenemase genes.

Results:

A. baumannii was isolated from 38.5% of hospital patient burn wounds and 22.1% of surfaces, including burn units (15.6%) and intensive care units (52.4%). Antibiotic susceptibility results showed that (100%) of burn patient isolates were resistant to imipenem, while (100%) of ICU isolates and (96.8%) of burn isolates were resistant to imipenem. All clinical isolates were identified as MDR and XDR, whereas all (100%) and 98.1% of environmental isolates were identified as MDR and XDR, respectively. All studied A. baumannii isolates carried blaOXA-51-like gene. Moreover, 50 (94.3%) and 49 (92.5%) of environmental isolates, 32 (100%) and 30 (93.7%) of burn patient isolate harbored blaOXA-23-like and blaOXA-24/40–like genes, respectively. None of the isolates carried the blaOXA-58 or blaOXA-143 genes and all isolates had at least 2 OXA-type carbapenemase genes.

Conclusion:

Our results suggest that surfaces in the hospital environment, particularly in ICUs, are contaminated with MDR or XDR A. baumannii strains. They may be considered a potential reservoir for the colonization of hospital patients. In addition, OXA-type carbapenemases, including OXA-23-like and OXA-24/40-like, appear to be one of the major mechanisms of carbapenem resistance in the clinical and environmental A. baumannii strains.

Keywords: Acinetobacter baumannii, Hospital environment, OXA-type carbapenemases, Burns centers, Molecular detection, Burn units.

1. INTRODUCTION

Acinetobacter baumannii is known as a major cause of nosocomial infections, especially in intensive care units (ICUs) and in patients with burns [1, 2]. The ability of this bacterium to acquire antibiotic resistance and its high persistence on hospital surfaces over long periods of time have made this bacterium a dangerous hospital pathogen [3, 4]. Patients with burns are susceptible to colonization with the organism in the hospital environment and are also considered a source of environmental contamination [5]. One of the most important features of this bacterium is the high potential for the acquisition of antibiotic resistance genes by mobile genetic elements (MGEs) such as plasmids, transposons, and integrons, leading to the formation of multidrug-resistant (MDR) strains [6]. Treatment of infections caused by MDR A. baumannii is one of the major health problems. Due to increasing antibiotic resistance, carbapenems have been proposed as the treatment of choice for infections caused by MDR A. baumannii strains [6]. Unfortunately, increasing resistance of A. baumannii strains to carbapenems has been reported in various parts of the world over the past decade [7, 8].

Resistance to carbapenems arises by several mechanisms, the most important of which is the production of carbapenemase enzymes [9]. The most common carbapenemases in A. baumannii belong to the Carbapenem-Hydrolyzing Class D β-lactamases (CHDLs) are known as oxacillinases or OXA-type enzymes [9, 10]. OXA-type carbapenemases (OTCs) are classified into several phylogenetic subgroups, the most common of which are detected in A. baumannii, including OXA-23-like, OXA-24/40-like, OXA-58-like, OXA-51-like, and OXA-143-like [11-13]. The first OTC (OXA-23) in A. baumannii was isolated in 1985 in a Scottish hospital [14]. The gene encoding this enzyme is blaOXA-23, mainly located on the plasmid [15]. The OXA-51-like is the largest subgroup and contains enzymes encoded by chromosomes [16]. It has been shown that blaOXA-51-like genes are ubiquitous in A. baumannii. Incorporation of ISAba1 elements upstream of blaOXA-51-like genes may act as promoters to increase gene expression and ultimately increase resistance to carbapenems [17]. Enzymes grouped in the subgroup OXA-58-like can be located on plasmids, which explains their widespread distribution [18]. OXA-24/40-like, originally known as OXA-24, is another OTC subgroup associated with both chromosomes and plasmids, and finally OXA-143-like is a plasmid-encoded mutant of the OXA-24/40 subgroup [12, 15].

Several studies have been performed on the molecular investigation of OXA-type carbapenemases in clinical isolates of A. baumannii. However, there is limited information on strains of environmental origin and their possible association with patient isolates [19, 20]. The aim of the study was to investigate the prevalence of OXA-type carbapenemases in A. baumannii strains isolated from burn patients and from the hospital environment.

2. METHODS

2.1. Bacterial Isolates

A total of 85 non-duplicated A. baumannii isolates (53 from environmental surfaces and 32 from burn patients) were collected from Burns Hospital in Tehran between April 2020 and May 2021. The environmental A. baumannii isolates were collected by swabbing the hospital surfaces in burn wards and ICUs, including medical devices, bed surfaces, bedside tables, door and window handles and personal belongings of patients. Burn wound swabs were taken from patients during the same period. Swabs obtained were transferred to Brain Heart Infusion (BHI) media (Merck, Germany) and incubated at 37°C. After overnight incubation, samples were inoculated onto blood agar (Merck, Germany) and MacConkey agar (Merck, Germany) and incubated at 37°C for 24 hours. Identification of A. baumannii isolates was made using standard biochemical tests. The isolates were finally confirmed as A. baumannii by PCR -sequencing of the rpoB gene [21].

2.2. Susceptibility Testing

The antimicrobial susceptibility of A. baumannii was determined using the disk diffusion method as recommended by Clinical and Laboratory Standards Institute (CLSI) 2020 guidelines [22]. The antibiotic plates tested (Mast, UK) contained: imipenem (10 µg), ciprofloxacin (5 µg), ceftazidime (30µg), gentamicin (10 µg), minocycline (30 μg), ampicillin-sulbactam (20 µg), doxycycline (30 µg), and trimethoprim/sulfamethoxazole (1.25/23.75 μg). Susceptibility to colistin and tigecycline was measured, and resistance to imipenem was confirmed by determining minimum inhibitory concentrations (MIC) using the broth microdilution method according to CLSI guidelines [22]. Tigecycline resistance was interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) (tigecycline resistance was defined as a MIC of > 2 µg/ml) [23]. MDR, extensively drug-resistant (XDR) and pan-drug resistant (PDR) A. baumannii isolates were defined as acquired non-susceptible to at least one agent in three or more antimicrobial classes, non-susceptible to at least one agent in all but two or fewer antimicrobial classes and non-susceptibility to all antimicrobial agents, respectively [24]. The control strain was Escherichia coli (ATCC 25922) and Pseudomonas aeruginosa (ATCC 27853).

2.3. Detection of OXA-type Carbapenemases Genes

Genomic DNA of A. baumannii isolates was extracted by boiling method and polymerase chain reaction (PCR) assays were performed to detect OXA-23-like, OXA-24/40 -like, OXA-58-like, OXA-51-like, and OXA-143-like genes as described previously [25]. Primers used to amplify targeted genes are listed in Table 1. The amplification programs of blaOXA-23-like, blaOXA-24 /40 -like, blaOXA-58-like, blaOXA-51-like genes were as follows: one cycle initial denaturation temperature of 94°C for 5 min; 30 cycles of amplification with a denaturation temperature of 94°C for 25 s; annealing temperature of 54°C for 40 s and extension temperature of 72°C for 50 s, ending with a final extension temperature of 72ºC for 6 min. The amplification of the blaOXA-143-like gene was performed using PCR conditions as described previously [23]. The PCR products were visualized under an Ultraviolet (UV) transilluminator (Bio-Rad, UK) after electrophoresis on 1% gel agarose stained with GelRed®.

2.4. Statistical Analysis

Data were statistically analyzed using Statistical Package for the Social Sciences (SPSS) version 21 software (SPSS, Inc). Differences between variables were compared using chi-square (χ2) or Fisher's exact test, and P values less than 0.05 were considered significant.

3. RESULTS

A. baumannii was identified in 53 (22.1%) of the 240 samples collected from hospital environments as follows: environmental surfaces of intensive care units (22/42), including (15 medical equipment, 4 bed surfaces, 1 door handle, and 2 other sites) and burn units (31/198), including (4 medical equipment, 10 bed surfaces, 11 bedside Table 2 door and window handles, and 4 other sites). On the other hand, 32 (38.5%) A. baumannii strains were isolated from burn wounds of 83 hospitalized patients. Antimicrobial susceptibility testing showed that the strains were highly resistant to ceftazidime, trimethoprim/sulfamethoxazole, imipenem, ciprofloxacin, and gentamicin (Table 2). MIC determination indicated that all (100%) of ICU and (96.8%) of burn unit from environmental isolates and 100% clinical isolates were resistant to imipenem, whereas all (100%) environmental and clinical isolates were sensitive to colistin and tigecycline. All clinical isolates were identified as MDR and XDR, whereas all (100%) and 52(98.1%) of environmental A. baumannii isolates showed MDR and XDR phenotypes, respectively. None of the isolates (environmental and clinical isolates) were also found to be a PDR strain. The blaOXA-51-like gene was detected in all (100%) environmental and clinical A. baumannii isolates. Fifty (94.3%) and 49 (92.5%) of isolates from hospital environments, and 32 (100%) and 30 (93.7%) of isolates from burn patients possessed OXA-23-like and OXA-24/40–like, respectively. In addition, the OXA-143-like and OXA-58-like were not identified in any isolates. All strains carried more than one OTCs gene. The characteristics of the isolates that carried more than one gene are shown in Table 3. Statistical analysis of antibiotic resistance rates and OTCs gene transmission showed no significant association between the clinical and environmental isolates (P > 0.05). In addition, no significant differences in the presence of OTCs genes and antibiotic resistance were also found between ICUs and burn units (P > 0.05), except for resistance to ciprofloxacin, which was significantly higher in isolates from ICUs (P = 0.035).

Table 1.
Primers to detect genes encoding OXA-type carbapenemases.
Primer Name Sequence (5´-3´) Product (bp) References
OXA-23-like F GAT CGG ATT GGA GAA CCA GA 501 [21]
OXA-23-like R ATT TCT GAC CGC ATT TCC AT
OXA-24 /40 -like F GGT TAG TTG GCC CCC TTA AA 246 [21]
OXA-24 /40 -like R AGT TGA GCG AAA AGG GGA TT
OXA-51-like F TAA TGC TTT GAT CGG CCT TG 353 [21]
OXA-51-like R TGG ATT GCA CTT CAT CTT GG
OXA-58 F GGA ATA GAG TGG CTT AAY TCT C 599 [21]
OXA-58 R GGT TTA AYA AAA CAA CCA CC
OXA-143 F TGGCACTTTCAGCAGTTCCT 149 [19]
OXA-143 R TAATCTTGAGGGGGCCAACC
Table 2.
Antimicrobial resistance of environmental and clinical Acinetobacter baumannii isolates by disk diffusion method.
Antibiotic ICUs Burn Wards P-value Environmental Isolates Burn Patients P-value
R, N (%) I, N (%) S, N (%) R, N (%) I, N (%) S, N (%) R, N (%) I, N (%) S, N (%) R, N (%) I, N (%) S, N (%)
Imipenem 22 (100.0) 0 (0.0) 0 (0.0) 28(90.3) 2(6.5) 1(3.2) > 0.05 50 (94.3) 2 (3.8) 1 (1.9) 32(100.0) 0 (0.0) 0 (0.0) > 0.05
Ceftazidime 22 (100.0) 0 (0.0) 0 (0.0) 31 (100.0) 0 (0.0) 0 (0.0) > 0.05 53 (100.0) 0 (0.0) 0 (0.0) 32(100.0) 0 (0.0) 0 (0.0) > 0.05
Gentamicin 19 (86.3) 2 (9.1) 1 (4.5) 22 (70.9) 4 (13.0) 5 (16.1) > 0.05 41 (77.4) 6 (11.3) 6 (11.3) 29 (90.6) 1 (3.1) 2 (6.3) > 0.05
Doxycycline 3 (13..6) 0 (0.0) 19 (86.3) 0 (0.0) 0 (0.0) 31 (100.0) > 0.05 3 (5.7) 0 (0.0) 50 (94.3) 2 (6.3) 0 (0.0) 30 (93.7) > 0.05
Minocycline 2 (9.1) 0 (0.0) 20 (90.9) 0 (0.0) 0 (0.0) 31 (100.0) > 0.05 2 (3.8) 0 (0.0) 51 (96.2) 1 (3.1) 1 (3.1) 30 (93.7) > 0.05
Ciprofloxacin 22 (100.0) 0 (0.0) 0 (0.0) 25 (80.7) 1 (3.2) 5 (16.1) 0.035* 47 (88.7) 1 (1.9) 5 (9.4) 30 (93.7) 0 (0.0) 1 (3.1) > 0.05
Ampicillin-Sulbactam 0 (0.0) 2 (9.1) 20 (90.9) 0 (0.0) 0 (0.0) 31 (100.0) > 0.05 0 (0.0) 2 (3.8) 51 (96.2) 1 (3.1) 0 (0.0) 30 (93.7) > 0.05
Trimethoprim/Sulfamethoxazole 22 (100.0) 0 (0.0) 0 (0.0) 30 (96.8) 1 (3.2) 0 (0.0) > 0.05 52 (98.1) 1 (1.9) 0 (0.0) 32 (100.0) 0 (0.0) 0 (0.0) > 0.05
R: Resistant; I: Intermediate; S: Susceptible based on CLSI (2020) criteria. * Statistically significant (P ≤ 0.05).
Table 3.
Prevalence of OXA-type carbapenemase genes in A. baumannii isolates from Burns Hospital environmental surfaces and burn patients.
OXA-type Genes ICUs, N (%) Burn Wards, N (%) P value Hospital Surfaces, N (%) Burn Patients, N (%) P value
OXA-51-like + OXA-24/40-like 2 (9.1) 1 (3.2) > 0.05 3 (5.7) - -
OXA-51-like + OXA-23-like 1 (4.5) 3 (9.7) > 0.05 4 (7.5) 2 (6.2) > 0.05
OXA-51-like +OXA-23-like + OXA-24/40-like 19 (86.4) 27 (87.1) > 0.05 46 (86.8) 30 (93.8) > 0.05
Total 22 (100) 31 (100) 53 (100) 32 (100)

4. DISCUSSION

The ability of A. baumannii to survive for long periods of time on hospital surfaces and medical equipment, as well as its ability to acquire antibiotic resistance genes, have made this bacterium one of the most important antibiotic-resistant bacteria causing nosocomial infections [26].

In the current study, the presence of A. baumannii was investigated in clinical isolates from burn patients and in environmental samples collected from burn units and intensive care units. Also, the antimicrobial resistance patterns and OXA-type carbapenemase genes of the studied isolates were compared. The results of our study showed that A. baumannii was isolated from a wide variety of surfaces in the hospital environment, especially from intensive care units (52.4%), indicating the wide distribution of this organism in the hospital and can be considered as a potential risk of colonization in hospital patients, especially patients in intensive care units.

The association between outbreaks of A. baumannii and environmental sources in hospitals, including patient beds and medical equipment, has been documented [27]. In a study conducted by Aygun et al. [28], A. baumannii was detected in 39.3% of samples from environmental surfaces in ICUs. In a previous study, 17% of patient beds were contaminated with A. baumannii, with ICU beds having the highest level of contamination [27].

Our results showed that medical equipment was the most contaminated surface in IUCs, suggesting that it could be a conceivable source of A. baumannii infection in these units. These findings underscore the importance of disinfecting medical instruments and surfaces based on standard protocols to prevent and reduce the transmission of A. baumannii from these sources.

It has been reported that surfaces in the hospital environment are a reservoir for MDR bacteria that can be transmitted to patients [29]. Considering that all of our clinical and environmental A. baumannii were MDR bacteria, this finding is alarming. Similar to ours, 98.8% and 100% of A. baumannii isolates from the hospital environment were identified as MDR in the studies by Raro et al. [26] and Nazari et al. [30], respectively. In severe infections caused by XDR strains of A. baumannii, such as bacteremia and ventilator-associated pneumonia (VAP), a mortality rate of 50% has been reported [31]. Since the high percentage of A. baumannii strains studied were XDR strains, their transmission from the environment to patients is considered a serious threat.

All A. baumannii strains tested in the current study carried the blaOXA-51-like carbapenemase genes, which are considered part of the microorganism's genetic content [32]. We also found an extremely high prevalence of blaOXA-23-like carbapenemase genes in A. baumannii strains, especially in clinical isolates, which is consistent with other studies in the world showing the global distribution of these genes [33]. Wu et al. [33], and Minandri et al. [34], have been found that blaOXA-23-like became significantly more prevalent and replaced other blaOXA carbapenemases genes such as blaOXA-58-like in A. baumannii strains [33, 34]. OXA-23 is also identified as the most common OXA type carbapenemase in A. baumannii isolates from various hospital environments in Isfahan, Iran [27]. The blaOXA-24/40–like was another high prevalent gene detected in the present study and its prevalence in A. baumannii isolates was much higher than in previous studies in Iran [27]. In a study of an outbreak of MDR A. baumannii, the blaOXA-24 carbapenemase was detected in all isolates and the surface of a serum container was identified as a source of infection [35]. OXA-24-producer A. baumannii strains have been documented as endemic in Spain [36, 37]. The prevalence of OXA-24/40-like in our study could indicate that the OXA-24/40-like producing A. baumannii strains are increasing. Similar to other studies, the blaOXA-143-like and blaOXA-58-like were not found among any of the clinical and environmental A. baumannii isolates [30]. Other studies in Northwest Iran in 2012 and in Tehran in 2008, have been reported a prevalence of 3.2% and 9% of blaOXA-58-like among clinical samples of A. baumannii respectively [38, 39]. It can be concluded that the prevalence of blaOXA-58-like in our region is decreasing over time and has been replaced by other OXA-type carbapenemases genes. Another interesting finding was that all A. baumannii isolates carried more than one gene encoding OXA-type carbapenemase, such that 93.8% of clinical isolates and 86.8% of environmental isolates had three of the above genes simultaneously. The co-existence of blaOXA-51-like, blaOXA-23-like and/blaOXA-24/40-like has been reported in other studies which can be associated with more effective resistance to carbapenems [40, 41].

CONCLUSION

Our results suggest that surfaces in the hospital environment, especially in the intensive care unit, are contaminated with MDR or XDR A. baumannii strains, which may be considered a potential reservoir for colonizing hospital patients. In addition, OXA-type carbapenemases, including OXA-23-like and OXA-24/40-like, appear to be the main mechanisms of carbapenem resistance in the clinical and environmental A. baumannii strains.

LIST OF ABBREVIATIONS

ATCC = American Type Culture Collection
BHI = Brain Heart Infusion
CLSI = Clinical and Laboratory Standards Institute

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The study was approved by the ethical clearance committees of the Alborz University of Medical Sciences (IR.ABZUMS.REC.1398.201).

HUMAN AND ANIMAL RIGHTS

No animals were used in this research. All procedures performed in studies were in accordance with the ethical standards of the institutional and/or research committee and with the 1975 Declaration of Helsinki, as revised in 2013.

CONSENT FOR PUBLICATION

Participants provided written informed consent.

STANDARD OF REPORTING

STROBE guidelines were followed in this study.

AVAILABILITY OF DATA AND MATERIALS

All data is included in the manuscript, and there is no additional data to deposit.

FUNDING

None.

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

The technical assistance of the staff of Microbiology Laboratory, the Department of Microbiology, School of Medicine, Alborz University of Medical Sciences are gratefully acknowledged. The results described in this paper formed part of an MSc student thesis.

REFERENCES

1
Kilic A, Li H, Mellmann A, et al. Acinetobacter septicus sp. nov. association with a nosocomial outbreak of bacteremia in a neonatal intensive care unit. J Clin Microbiol 2008; 46(3): 902-8.
2
Custovic A, Smajlovic J, Tihic N, Hadzic S, Ahmetagic S, Hadzagic H. Epidemiological monitoring of nosocomial infections caused by acinetobacter baumannii. Med Arh 2014; 68(6): 402-6.
3
Kakoullis L, Papachristodoulou E, Chra P, Panos G. Mechanisms of antibiotic resistance in important gram-positive and gram-negative pathogens and novel antibiotic solutions. Antibiotics (Basel) 2021; 10(4): 415.
4
Bagheri Josheghani S, Moniri R, Firoozeh F, et al. Emergence of blaOXA-carrying carbapenem resistance in multidrug-resistant Acinetobacter baumannii in the intensive care unit. Iran Red Crescent Med J 2017; 19(5): e27327. [http://doi.org/10.5812/ircmj.27327].
5
Piran A, Shahcheraghi F, Solgi H, Rohani M, Badmasti F. A reliable combination method to identification and typing of epidemic and endemic clones among clinical isolates of Acinetobacter baumannii. Infect Genet Evol 2017; 54: 501-7.
6
Srinivasan VB, Rajamohan G, Pancholi P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann Clin Microbiol Antimicrob 2009; 8(1): 21.
7
Bonfiglio G, Russo G, Nicoletti G. Recent developments in carbapenems. Expert Opin Investig Drugs 2002; 11(4): 529-44.
8
Firoozeh F, Mahluji Z, Shams E, Khorshidi A, Zibaei M. New Delhi metallo-β-lactamase-1-producing Klebsiella pneumoniae isolates in hospitalized patients in Kashan, Iran. Iran J Microbiol 2017; 9(5): 283-7. [PMID: 29296273].
9
Opazo A, Domínguez M, Bello H, Amyes SG, González-Rocha G. OXA-type carbapenemases in Acinetobacter baumannii in South America. J Infect Dev Ctries 2012; 6(4): 311-6.
10
Ayibieke A, Kobayashi A, Suzuki M, et al. Prevalence and characterization of carbapenem-hydrolyzing class D β-lactamase-producing Acinetobacter isolates from Ghana. Front Microbiol 2020; 11: 587398.
11
Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008; 21(3): 538-82.
12
Higgins PG, Poirel L, Lehmann M, Nordmann P, Seifert H. OXA-143, a novel carbapenem-hydrolyzing class D beta-lactamase in Acinetobacter baumannii. Antimicrob Agents Chemother 2009; 53(12): 5035-8.
13
Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother 2010; 65(2): 233-8.
14
Donald HM, Scaife W, Amyes SG, Young HK. Sequence analysis of ARI-1, a novel OXA beta-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92. Antimicrob Agents Chemother 2000; 44(1): 196-9.
15
Antunes NT, Fisher JF. Acquired Class D β-Lactamases. Antibiotics (Basel) 2014; 3(3): 398-434.
16
Walther-Rasmussen J, Høiby N. OXA-type carbapenemases. J Antimicrob Chemother 2006; 57(3): 373-83.
17
Wong MH, Chan BK, Chan EW, Chen S. Over-expression of ISAba1-linked itrinsic and exogenously acquired OXA type carbapenem-hydrolyzing-class D-ß-lactamase-encoding genes is key mechanism underlying carbapenem resistance in Acinetobacter baumannii. Front Microbiol 2019; 10: 2809.
18
Koh TH, Sng LH, Wang GC, Hsu LY, Zhao Y. IMP-4 and OXA beta-lactamases in Acinetobacter baumannii from Singapore. J Antimicrob Chemother 2007; 59(4): 627-32.
19
Hrenovic J, Durn G, Goic-Barisic I, Kovacic A, Kovacic A. Occurrence of an environmental Acinetobacter baumannii strain similar to a clinical isolate in paleosol from Croatia. Appl Environ Microbiol 2014; 80(9): 2860-6.
20
Uwingabiye J, Lemnouer A, Roca I, et al. Clonal diversity and detection of carbapenem resistance encoding genes among multidrug-resistant Acinetobacter baumannii isolates recovered from patients and environment in two intensive care units in a Moroccan hospital. Antimicrob Resist Infect Control 2017; 6(1): 99.
21
Nikibakhsh M, Firoozeh F, Badmasti F, Kabir K, Zibaei M. Molecular study of metallo-β-lactamases and integrons in Acinetobacter baumannii isolates from burn patients. BMC Infect Dis 2021; 21(1): 782.
22
Clinical and laboratory standards institute; Performance standards for antimicrobial susceptibility testing 30th information supplement. 2020; M100-S30.
23
Wang TH, Leu YS, Wang NY, Liu CP, Yan TR. Prevalence of different carbapenemase genes among carbapenem-resistant Acinetobacter baumannii blood isolates in Taiwan. Antimicrob Resist Infect Control 2018; 7(1): 123.
24
Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012; 18(3): 268-81.
25
Woodford N, Ellington MJ, Coelho JM, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006; 27(4): 351-3.
26
Raro OHF, Gallo SW, Ferreira CAS, Oliveira SD. Carbapenem-resistant Acinetobacter baumannii contamination in an intensive care unit. Rev Soc Bras Med Trop 2017; 50(2): 167-72.
27
Shamsizadeh Z, Nikaeen M, Nasr Esfahani B, Mirhoseini SH, Hatamzadeh M, Hassanzadeh A. Detection of antibiotic resistant Acinetobacter baumannii in various hospital environments: potential sources for transmission of Acinetobacter infections. Environ Health Prev Med 2017; 22(1): 44.
28
Aygün G, Demirkiran O, Utku T, et al. Environmental contamination during a carbapenem-resistant Acinetobacter baumannii outbreak in an intensive care unit. J Hosp Infect 2002; 52(4): 259-62.
29
Hess AS, Shardell M, Johnson JK, et al. A randomized controlled trial of enhanced cleaning to reduce contamination of healthcare worker gowns and gloves with multidrug-resistant bacteria. Infect Control Hosp Epidemiol 2013; 34(5): 487-93.
30
Nazari M, Youzbashi Z, Khaledi M, Fathi J, Afkhami H. Detection of carbapenem resistance and virulence genes among Acinetobacter baumannii isolated from hospital environments in center of Iran. J Current Biomed Reports 2021; 2(1): 1-7. [https://doi.org/10.52547/JCBioR.2.1.14].
31
Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg B. Clinical and pathophysiological overview of Acinetobacter infections: a century of challenges. Clin Microbiol Rev 2017; 30(1): 409-47.
32
Leski TA, Bangura U, Jimmy DH, et al. Identification of blaOXA-51-like, blaOXA-58, blaDIM-1, and blaVIM carbapenemase genes in hospital Enterobacteriaceae isolates from Sierra Leone. J Clin Microbiol 2013; 51(7): 2435-8.
33
Wu W, He Y, Lu J, Lu Y, Wu J, Liu Y. Transition of blaOXA-58-like to blaOXA-23-like in Acinetobacter baumannii Clinical Isolates in Southern China: An 8-Year Study. PLoS One 2015; 10(9): e0137174.
34
Minandri F, D’Arezzo S, Antunes LC, et al. Evidence of diversity among epidemiologically related carbapenemase-producing Acinetobacter baumannii strains belonging to international clonal lineage II. J Clin Microbiol 2012; 50(3): 590-7.
35
Tena D, Martínez NM, Oteo J, et al. Outbreak of multiresistant OXA-24- and OXA-51-producing Acinetobacter baumannii in an internal medicine ward. Jpn J Infect Dis 2013; 66(4): 323-6.
36
Acosta J, Merino M, Viedma E, et al. Multidrug-resistant Acinetobacter baumannii Harboring OXA-24 carbapenemase, Spain. Emerg Infect Dis 2011; 17(6): 1064-7.
37
Bou G, Cerveró G, Domínguez MA, Quereda C, Martínez-Beltrán J. Characterization of a nosocomial outbreak caused by a multiresistant Acinetobacter baumannii strain with a carbapenem-hydrolyzing enzyme: high-level carbapenem resistance in A. baumannii is not due solely to the presence of beta-lactamases. J Clin Microbiol 2000; 38(9): 3299-305.
38
Sohrabi N, Farajnia S, Akhi MT, et al. Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of Iran. Microb Drug Resist 2012; 18(4): 385-9.
39
Karmostaji A, Najar Peerayeh S, Salmanian AH. Distribution of OXA-Type class D β-lactamase genes among nosocomial multi drug resistant Acinetobacter baumannii isolated in Tehran Hospitals. Jundishapur J Microbiol 2013; 6(5): e8219. [http://doi.org/10.5812/jjm.8219].
40
Taherikalani M, Fatolahzadeh B, Emaneini M, Soroush S, Feizabadi MM. Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitals. New Microbiol 2009; 32(3): 265-71.
42
Feizabadi MM, Fathollahzadeh B, Taherikalani M, et al. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis 2008; 61(4): 274-8.