All published articles of this journal are available on ScienceDirect.
The Frequency of the Intestinal Parasites Giardia Lamblia and Entamoeba Histolytica in Pediatric Diarrhea Specimens from Central Iran
Authors Info & Affiliations
Abstract
Introduction:
Intestinal parasitic infections, particularly those caused by Giardia lamblia, are among the major health problems that exist worldwide, especially in developing countries. This study aimed to investigate the prevalence of the intestinal parasites Giardia lamblia and Entamoeba histolytica that were isolated from samples of infectious diarrhea in pediatric patients from Central Iran.
Methods:
This descriptive cross-sectional study included 230 samples of infectious diarrhea that were collected from May 2015 to February 2016. Direct observation, the formalin-ether sedimentation method and the technique using the Polymerase Chain Reaction (PCR) of β-giardin and EH primers were used for the identification of Giardia lamblia and Entamoeba histolytica.
Results:
Out of 230 samples of infectious diarrhea, five cases (2.1%) of Giardia lamblia and no cases (0%) of Entamoeba histolytica were identified using the formalin-ether sedimentation method and the same result were obtained using PCR technique. Of the five patients who had Giardia lamblia, three (60%) were male and two (40%) were female. The most common clinical symptoms in these patients were stomach ache and diarrhea (100%) and mucus in the stool (80%).
Conclusion:
Giardia lamblia was introduced as a parasitic agent causing diarrhea from Central Iran. The results indicate that pediatricians and, even more importantly, experts in laboratories should pay special attention to the identification of this parasite to treat the patients as effectively and as quickly as possible.
1. INTRODUCTION
Being contaminated with parasitic infections is now believed to be inextricably intertwined with personal hygiene, individual conduct, and the social scales of people in terms of their sanitary awareness. Consequently, hygiene and health scale evaluation are considered to be among the yardsticks of measurement, specifically for those in developing countries [1]. In spite of the enormous efforts made by the World Health Organization (WHO), the exposure to parasitic infections is
highly prevalent in developing countries and is particularly widespread in communities where there are poor sanitary conditions and economic and social disadvantages [2].
According to reports issued by the WHO over the past 2010 years, almost two-thirds of the world’s population is contaminated by parasitic infections, of which the most prevalent is Giardia lamblia [3]. Among the parasitic infections of the digestive system, Giardia lamblia and Entamoeba histolytica are principal pathogenic protozoa. The number of those who are afflicted with Giardia lamblia has in fact reached epidemic proportions worldwide, and it is the most commonly found parasite in excrement samples collected in Iran [4]. The prevalence of this protozoan in developing countries fluctuates between 2% and 30%, whereas in industrialized countries the reported figures vary from 2% up to just 7% [5]. Giardia lamblia is capable of causing asymptomatic contamination or spectral diseases, and infections range from acute to chronic, with clinical symptoms such as acute watery diarrhea, abdominal cramps, maladaptation syndrome, and weight loss among both infants and children [6].
Entamoeba histolytica, which is mainly a cause of amoebiasis (amoebic bloody diarrhea), involves primary pathogenic protozoans in the human body [4]. Studies conducted between 1988 to 2009 found a prevalence of less than 1.3% in different parts of Iran [7]. However, identifying intestinal parasites in clinical detection labs is not carried out efficiently, and there is no specific information concerning the abundance scale of parasites, such as Giardia lamblia and Entamoeba histolytica in Iran’s central region. Therefore, this study is being conducted to examine the in depth abundance scales of Giardia lamblia and Entamoeba histolytica, by examining samples of diarrhea from pediatric patients who were referred to the pediatric educational and therapeutic center at the Arak University of Medical Sciences (Amir Kabir Hospital).
2. MATERIALS AND METHODS
2.1. Collecting Samples
For this sectional descriptive study, 230 samples of diarrhea were collected from pediatric patients who were referred to the Amir Kabir Medical Center from the beginning of May (the second month of the year in accordance with the solar calendar) 2015 to the end of February (The eighth month of the year in accordance with the solar calendar), 2016. This study was approved by the Ethics Committee of the Arak University of Medical Sciences under No. 93-176-10.
2.2. Microscopic Observation
The procedure was carried out using direct and formalin-ether sedimentation methods and according to WHO protocol, using samples of diarrhea that were collected in less than 10 minutes. The formalin-ether sedimentation method was used as described elsewhere [8].
The clinical sample that was available through Valiasr Hospital’s part of parasitology was used during this procedure as a positive control.
2.3. DNA Extraction and PCR Analysis
DNA extraction from samples of feces, using the QIAamp DNA Stool Mini Kit by Qiagen GmbH Hilden Germany, was conducted as per the protocol. The amount and purity of the extracted DNA were measured with a NanoDrop apparatus. The primers B-giardinand EH were deployed as genetic markers to validate the isolated Giardia lamblia and Entamoeba histolytica in the PCR (Table 1) [9, 10].
The eventual volume of PCR used in this study was 25 µl, which consisted of 12.5 µlof the master mix (1X), 0.5 µl of Taq DNA Polymerase (2.5 units), 10 µl of the forward and reverse primers (10 pm), 2 µl of the DNA sample (5 ng), and 8 µl of the twice distilled water. (All the substances were purchased from Yekta Tajhiz Corporation, Iran). From each positive gene, a sample was tested using the sequencing of isolated PCR products (Gene Fanavaran Corporation, Iran), which was verified using Blast analysis.
3. RESULTS
Of the 230 analyzed samples, five of the Giardia lamblia samples (2.1%) and none of the Entamoeba histolytica samples (0%) were found to be positive using direct observation and the Formalin-ether sedimentation technique; this finding was also confirmed by PCR. Four Balantidium coli samples (80%) were obtained from the five Giardia lamblia samples (2.1%) using the direct observation method, and one cyst (20%) was found using the Formalin-ether sedimentation technique.
The average age of the people afflicted with Giardia lamblia was 5 years and 8 months. The youngest diseased person was a 4-year-old boy; the oldest was an 8-year-old girl. Of the five patients (2.1%) afflicted with Giardia lamblia, three (60%) were male and two (40%) were female.
The clinical symptoms among the people suffering from giardiasis included stomachache and diarrhea (100%), mucus spotted in feces (80%), and nausea and anorexia (60%).
4. DISCUSSION
Intestinal parasitic infections are widespread across the world, and they often occur among people in poor social and economic circumstances, miserable living conditions, and densely populated regions deprived of proper sanitary protection, with inappropriate garbage disposal mechanisms, poor water quality, and unsanitary hygiene habits [11, 12].
In this study, five patients (2.1%) were infected with Giardia lamblia. In other studies carried out in Iran, the percentages of patients with Giardia lamblia were: 2.3% in Tehran, 4.1% in the northern regions of the country, and 10.9% in Hamedan; in Italy, 6.5% of the patients were infected with Giardia lamblia; in Jordan, 29.6% were infected with it [13-17]. The difference in the prevalence of Giardia lamblia infection reported in different studies is due to the differences
| References | Annealing Temperature | Amplicon size (bp) | Sequence 5'→3' | Primer | Target Gene Description |
| [9] | 60 | 171 | F: 5- AAGTGCGTCAACGAGCAGCT-3 R: 5- TTAGTGCTTTGTGACCATCGA -3 |
β-giardin -F β-giardin -R |
Giardia lamblia |
| [10] | 56 | 170 | F: 5- AAGCATTGTTTCTAGATCTGAG-3 R: 5- AAGAGGTCTAACCGAAATTAG-3 |
EH -F EH -R |
E. histolytica species |
in the time, geographical living areas, and the hygiene habits and lifestyles in which the samples were obtained [17].
Amoebiasis is still reported to be one of the most consequential health maladies in tropical and subtropical areas [18]. The outbreak from Entamoeba histolytica is yet to be recognized, whether in Iran or other major parts of the planet [19].
Many studies have scrutinized the prevalence of Entamoeba histolytica, and its impact on certain groups of people in Iran. There is no evidence of the prevalence of Entamoeba histolytica in our study; however, in other studies conducted in Iran, the prevalence of Entamoeba histolytica was found to be 0.02% in Karaj, 0.1% in the northern region of Iran, and 0.4% in Oromia; the prevalence is 4.7% in Saudi Arabia and 18.8% in South Africa [17, 20-23]. The samples of intestinal parasitic infections collected from people can vary due to differences in their hygiene habits and lifestyles, and differences in the time and geographical living areas in which the samples are obtained [24-26].
The initial technique is to detect Balantidium coli, Giardia lamblia and Entamoeba histolytica within feces using a microscope. A PCR test can also be used for the detection of feces [27, 28]. Of these two methods of microscopic observation and PCR, the sensitivity of the PCR method was higher [27]. PCR can accurately identify parasitic species, and it produces less laboratory waste than microscopic observation methods [27]. In spite of being ultrasensitive and exclusive for detecting Giardia lamblia and Entamoeba histolytica, the use of molecular techniques, such as PCR, is extensively restricted to laboratories [27]. The microscopic method is unable to differentiate Entamoeba histolytica from Entamoeba dispar. Thus, the WHO recommends the development and utilization of new techniques, such as PCR for a specific diagnosis of Entamoeba histolytica infection [28]. It is not possible to distinguish Entamoeba histolytica from commensal species, Entamoeba dispar, with morphological indices and only using specific monoclonal antibodies for each species and genomic testing by PCR is possible [8].
In the present study, the average age of the people contaminated with giardiasis was 5 years and 8 months. In Ghana, the average age infected person was less than a year. The highest prevalence was found in children, under the age of 10, in Karaj, Iran [29, 30]. In the present study, to some extent, men were more often inflicted than women, which was virtually identical to the findings reported in a study conducted in the northern region of Iran [17].
In the present study, the most prevalent clinical symptoms among the afflicted patients were stomachache and diarrhea (100%) and mucus in the feces (80%); in a study conducted in Pakistan, the principal clinical symptoms among the patients were abdominal muscle cramps, nausea, vomiting, flatulence, anorexia, and weight loss. The most common clinical symptom was nausea, which was found in 77.6% of the people; the least common clinical symptom was diarrhea, which was found in 19.7% of the people [30, 31].
CONCLUSION
To date, detailed investigations about intestinal parasites in various parts of the world have suggested that this type of infection is still a hygiene-related issue, due to the provision of sanitary services, notably in countries lacking basic amenities. In this study, Giardia lamblia was the parasite with the highest number of leading-to-diarrhea protozoans from pediatric patients in the central part of Iran; thus, pediatricians, and especially laboratory authorities, should be exceedingly vigilant in order to detect this protozoan to ensure proper and early medical treatment for affected patients. Due to the high sensitivity of the PCR method, there is a need to use this method in clinical diagnostic laboratories. As no case of Entamoeba histolytica has been observed in this geographical region, which is due to the its increased information and social awareness of hygiene practices, and decreased use of contaminated water supplies and unwashed vegetables.
LIST OF ABBREVIATIONS
| WHO | = World Health Organization, |
| DNA | = Deoxyribonucleic Acid, |
| PCR | = Polymerase Chain Reaction, |
| BLAST | = Basic Local Alignment Search Tool. |
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
This study was approved by the Ethics Committee of the Arak University of Medical Sciences under the approval no. 93-176-10.
HUMAN AND ANIMAL RIGHTS
No animals were used in the study. All reported human were experimented in accordance with the ethical standards of the committee responsible for human experimentation (institutional and national), and with the Helsniki Declaration of 1975, as revised in 2008 http://www.wma.net/en/20activities/10ethics/10helsinki/.
CONSENT FOR PUBLICATION
Informed consent was obtained from a parent and/or guardian for participants under 16 years old. The authors neither use nor access any information that enabled them to identify individual patients.
AVAILABILITY OF DATA AND MATERIALS
The data supporting the findings of the article is available in the manuscript.
FUNDING
This work was financially supported by the Arak University of Medical Sciences (Number: 2116).
CONFLICTS OF INTEREST
The authors declare no conflict of interest, financial or otherwise.
ACKNOWLEDGEMENTS
The authors gratefully acknowledge the educational assistance of Arak University of Medical Sciences due to its financial contributions to support this study.
