RESEARCH ARTICLE
Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Hossein Samadi Kafil 1, Ashraf Mohabati Mobarez 2, *
Article Information
Identifiers and Pagination:
Year: 2015Volume: 9
First Page: 14
Last Page: 17
Publisher ID: TOMICROJ-9-14
DOI: 10.2174/1874285801509010014
Article History:
Received Date: 26/1/2015Revision Received Date: 21/2/2015
Acceptance Date: 1/3/2015
Electronic publication date: 26/6/2015
Collection year: 2015
open-access license: This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.
Abstract
Enterococci rank among leading cause of nosocomial bacteremia and urinary tract infection in hospital and community acquired infections. Several traits that may contribute to enhanced virulence have been identified in Enterococci. Extracellular surface protein (Esp) is a virulence factor that contributes in biofilm formation and resistance to environmental stresses. In this study we aimed to determine occurrence of esp in E. faecium and E. faecalis isolates isolated from urinary tract infections and to investigate whether there is any correlation between presence of esp and antibiotic resistance. One hundred and sixty six isolates were collected from patients with UTI and after identification by biochemical and PCR, antibiotic resistances were examined. The presence of esp was investigated by primer-specific PCR. 43.3% of isolates identified as E. faecium and 56.7% as E. faecalis. The esp gene was found in 76.1% of E. faecium isolates and 77.9% of E. faecalis isolate. There were significant correlation between esp positive E. faecium and resistance to Vancomycin (p<0.01), also in E.faecalis we found correlation between esp positive and resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.01, p<0.01, p<0.01 respectively). Occurrence of esp in our isolates from urinary tract infection was high that indicates importance of this gene in urinary tract infections and shows importance of ability to forming biofilm and hydrophobicity of surface of Enterococci for causing urinary infection by Enterococci. Also, our finding showed significant correlation between resistance to antibiotics and presence of esp in Enterococci.
INTRODUCTION
For many years Enterococci species believed to be harmless and considered medically unimportant, because they produce bacteriocins, and they have been used in food industry as starter for dairy products and probiotic [1], but recently Enterococci have been emerged as an important nosocomial pathogens and are among the most frequently isolated organisms in hospital-acquired infections [2]. At present Enterococci is known as important nosocomial infections such as endocarditis [3] bacteremia [3, 4] and urinary tract infections [5]. The majority of enterococcal infections are caused by E. faecalis. However, in parallel with the increase in nosocomial Enterococci infections, a partial replacement of E. faecalis by E. faecium took place in the world [6, 7]. Little is known about enterococcal properties which make it possible for the bacteria to adhere and colonize the host tissue [8]. Several traits that may contribute to enhanced virulence have been identified in Enterococci, but better understanding of the virulence of Enterococci is necessary to control further spread and developing new treatment strategies [6].
Extracellular surface protein (esp) is a cell wall associated protein first described in Enterococcus species by Shankar et al. [9]. It is thought to promote adhesion, colonization and evasion of the immune system, and to play some role in antibiotic resistance [1]. It has also contributions in biofilm formation of Enterococci, which lead to resistance to environmental stresses, and adhesion to eukaryotic cells, such as those of the urinary tract [10]. Shankar et al. showed contribution of esp in the persistence of Enterococci in the animal model of urinary tract infections [11]. In this study we aimed to determine presence of esp gene in E. faecium and E. faecalis isolated from urinary tract infections and to investigate any relationship between presence of esp gene and rate of antibiotic resistance.
MATERIALS AND METHODS
Study Design
One hundred and sixty six clinical isolates of Enterococci were collected from patients with urinary tract infections. The isolates were identified as Enterococci and specified by biochemical tests [12]. Identification was confirmed by Mass Spectrophotometer (MALDI-TOF MS microflex, 2012 bruker, Germany) and PCR (as described below). Antibiotic resistance properties of strains were examined by kerby-bauer method according to CLSI guideline (CLSI M100-S24) [13].
DNA Extraction and PCR
DNA extraction was done by CinnapureTM DNA extraction kit (Cinnagen, Iran). Briefly, bacterial pellet was resuspended in 100 µl gram positive prelysis buffer and added 20 µl lysosyme and incubated at 37°C for at least 30 min. After adding lysis buffer and precipitation solution, the solution was transferred to a spin column and after washing the spin, DNA was eluted by elution buffer in 65°C [14]. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [15], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [16] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [9] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran). DNA was amplified by general PCR. An initial denaturation of 10 min at 94°C was followed by 35 cycles of denaturation at 94°C (1 min), annealing at 58°C for 1 min and extension at 72°C for 1 min, followed by a final extension at 72°C for 10 min. product length were 941bp for E. faecalis, 658bp for E. faecium and 95bp for esp. Positive control for PCR were E. faecalis MMH594 (also esp positive), E. faecalis 29212, E. faecium C38 and C68. Negative controls consisted of the PCR components on reaction mixtures lacking Enterococci DNA. PCR products were electrophoreses in 1.5% agarose gels and after staining with 0.5µg/ml ethidium bromide visualized under UV light. The size of fragments was determined in comparision with 100bp DNA ladder plus size marker (Fermentas., Germany).
Statistical Analysis
Chi-square test (or Fisher exact test) was performed for data analysis. P values below 0.05 were considered to be significant. Statistical analysis was done by Spss. 21 software.
Results
From 166 clinical isolates of urinary tract infections of Enterococci, 59.7% of isolates were from females and 40.3% from males. By biochemical differentiation and PCR for specific genes, 43.3% of isolates were identified as E. faecium and 56.7% as E. faecalis. Antibiotic resistance of strain described by disc diffusion (Figs. 1 and 2) and the presence of esp gene was identified in 77.1% of all isolates of Enterococci. esp gene was identified in 76.1% of E. faecium and 77.9% of E. faecalis isolates (Fig. 3). There was not any significant difference between presence of esp gene in E. faecalis and E. faecium isolates (P> 0.05). Correlation of resistance to antibiotic and presence of the esp genes was investigated. In E. feacium, correlation was found between presence of the esp and resistance to Vancomycin (p<0.01) (Fig. 1). In E. faecalis we revealed correlation between resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.01, p<0.01 and p= 0.006 respectively) and presence of esp gene (Fig. 2).
Fig. (1). E. faecium Antibiotic resistance properties in Total and Esp positive strains. Sens: Sensitive; int: intermediate; res: resistance. |
Fig. (2). E.faecalis Antibiotic resistance properties in Total and Esp positive strains. Sens: Sensitive; int: intermediate; res: resistance. |
DISCUSSION
In the previous studies, several investigators have focused on the relationship between Enterococciesp gene and antibiotic resistance. The current investigation examined the relationship of Enterococciesp gene with antibiotic resistance of isolates from in the urinary tract infection. In this study we investigated the presence of esp in E. faecium and E. faecalis isolates from urinary tract infection. Enterococcal surface protein (esp) is considered as virulence factor in Enterococci, a few studies have done on presence and importance of esp on urinary tract infection of Enterococci. esp has been identified in E. faecium and E. faecalis previously [17], but not in other Enterococci [18]. We revealed high frequency of esp genes in both E. faecium and E. faecalis (76.1%, 77.9% respectively) isolated from urinary tract infection. It was higher rate than reported in previous studies on clinical samples [17, 19]. esp has been reported as the first important gene for biofilm formation in Enterococci [6, 9]. The ability to form biofilm on abiotic surfaces is considered to be an important virulence property of the Enterococci [20], biofilm is an assemblage of microbial cells associated with a surface and enclosed in a matrix of primarily polysaccharide material [16]. Defined architecture of the biofilm provides an optimal environment for the exchange of genetic material between bacteria and increases the innate resistance of the bacterium to antibiotic and activities of the host immune response [6, 21]. esp gene positive isolates were considered as expressing the esp protein [9, 22]. Results of this study shows importance of the biofilm formation and the presence of esp in clinical samples, especially in the urinary tract infections. The nature of urinary tract infections necessitate biofilm for bacteria, and presence of esp in most of urinary cultured Enterococci endorse importance of this gene for survival of bacteria in urinary tract. It has been also demonstrated that esp increased the hydrophobicity of bacterial surface [23]. Therefore, it can help Enterococci to match with urinary tract condition.
In this study, we found significant correlation between the presence of esp and the antibiotic resistance. Our data showed significant correlation between presence of esp gene and resistance to Vancomycin in E. faecium (Fig. 1) and resistance to Ampicillin, Chloramphenicol and Tetracycline (p<0.001, p<0.001, p<0.001) (Fig. 2) in E. faecalis. In a study by Billstrom et al, they revealed strong correlation between esp carriage and antimicrobial resistance to Ampicillin and Ciprofloxacin and Imipenem in clinical blood culture isolates of E. faecium [24]. But in our urinary tract isolates of E. faecium, we didn’t find similar correlation (Fig. 1). However, we found significant correlation with resistance to Vancomycin and presence of esp. Also in E. faecalis isolates we had significant correlation between the presence of esp and resistance to the Ampicillin, Tetracycline and Chloramphenicol (Fig. 2).
In conclusion, our finding provides additional evidence for the presence of esp in Enterococcus isolates from urinary tract infection and high rate of antibiotic resistance may lead to strong biofilm formers and strong adherent to host cells. These three factors may play an important role in enterococcal infections. The presence of these bacteria in urinary tract infection in addition to its multi resistance, close attention should be given to these strains in order to reduce risk for development of disease caused by Enterococci in other areas of the body. Furthermore, additional studies about role of esp expression on biofilm formation of enterococci is needed.
CONFLICT OF INTEREST
The authors confirm that this article content has no conflict of interest.
ACKNOWLEDGMENTS
We would like to thank all staff of educational hospitals for cooperation in collecting samples and antibiogram of isolates. Also we thank Dr. Hossein Navidinia for their helpful comments on manuscript.
FUNDING
This study was granted by Iran National Elite foundation for Hossein Samadi Kafil.