RESEARCH ARTICLE


Genomic Comparison of the Closely Related Salmonella enterica Serovars Enteritidis and Dublin



Laura Betancor a, b, Lucía Yim a, Arací Martínez a, b, Maria Fookesc, Sebastian Sasias a, Felipe Schelotto b, Nicholas Thomson c, Duncan Maskell d, José A Chabalgoity a, *
a Departamento de Desarrollo Biotecnológico, Instituto de Higiene, Facultad de Medicina, Universidad de la República, Av. A. Navarro 3051, CP 11600, Montevideo, Uruguay
b Departamento de Bacteriología y Virología, Instituto de Higiene, Facultad de Medicina, Universidad de la República, Av. A. Navarro 3051, CP 11600, Montevideo, Uruguay
c The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK
d Department of Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3 0ES, UK


Article Metrics

CrossRef Citations:
0
Total Statistics:

Full-Text HTML Views: 3830
Abstract HTML Views: 3438
PDF Downloads: 769
Total Views/Downloads: 8037
Unique Statistics:

Full-Text HTML Views: 1533
Abstract HTML Views: 1908
PDF Downloads: 538
Total Views/Downloads: 3979



Creative Commons License
© Betancor et al.; Licensee Bentham Open.

open-access license: This is an open access article licensed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.

* Address correspondence to this author at the Av. A. Navarro 3051, CP 11600, Montevideo, Uruguay; Tel: +59824871288 ext. 1120; Fax: +59824873073; E-mail: jachabal@higiene.edu.uy


Abstract

The Enteritidis and Dublin serovars of Salmonella enterica are closely related, yet they differ significantly in pathogenicity and epidemiology. S. Enteritidis is a broad host range serovar that commonly causes gastroenteritis and infrequently causes invasive disease in humans. S. Dublin mainly colonizes cattle but upon infecting humans often results in invasive disease.To gain a broader view of the extent of these differences we conducted microarray-based comparative genomics between several field isolates from each serovar. Genome degradation has been correlated with host adaptation in Salmonella, thus we also compared at whole genome scale the available genomic sequences of them to evaluate pseudogene composition within each serovar.

Microarray analysis revealed 3771 CDS shared by both serovars while 33 were only present in Enteritidis and 87 were exclusive to Dublin. Pseudogene evaluation showed 177 inactive CDS in S. Dublin which correspond to active genes in S. Enteritidis, nine of which are also inactive in the host adapted S. Gallinarum and S. Choleraesuis serovars. Sequencing of these 9 CDS in several S. Dublin clinical isolates revealed that they are pseudogenes in all of them, indicating that this feature is not peculiar to the sequenced strain. Among these CDS, shdA (Peyer´s patch colonization factor) and mglA (galactoside transport ATP binding protein), appear also to be inactive in the human adapted S. Typhi and S. Paratyphi A, suggesting that functionality of these genes may be relevant for the capacity of certain Salmonella serovars to infect a broad range of hosts.

Keywords: Comparative genomics, Host specificity, Pseudogenes, Salmonella, S. Dublin, S. Enteritidis.



1. INTRODUCTION

Infection with non-typhoidal Salmonella enterica is a major cause of food-borne disease in humans worldwide [1-3]. Animals and their products are regarded as the main sources of this pathogen, although it may also be present in other potential sources, such as fresh vegetables [4-6]. From over 2500 different serovars of Salmonella enterica (defined by their surface antigenic properties, both somatic O antigen and flagellar H antigens) about 50 are significant pathogens of animals and humans. Acute infections in humans can develop in one of four ways: enteric fever, gastroenteritis, bacteremia, or extraintestinal focal infection [7]. As with other infectious diseases, the course and outcome of the infection depend on a variety of factors, including the inoculating dose, the immune status of the host, and the genetic background of both the host and the infecting organism.

Although S. enterica serovars are genetically very similar, they differ significantly in host range and disease spectrum. S. enterica serovars may be classified as ubiquitous, host-restricted or host-specific. Ubiquitous serovars, which include Typhimurium and Enteritidis, most commonly produce self-limiting gastrointestinal infections in a wide range of hosts. Host-specific serovars, such as Typhi in humans or Gallinarum in fowl, cause severe systemic diseases in their specific hosts. A few Salmonella serovars, such as Choleraesuis and Dublin, have a narrow host range and are classified as host-restricted [8].

Host-restricted and host-specific serovars are generally more prone to cause invasive disease than ubiquitous serovars [9, 10]. Globally, human extra-intestinal salmonellosis is generally associated with those serovars that are also associated with gastroenteritis, as is the case with S. Enteritidis and S. Typhimurium. However, certain serovars are more prone to cause invasive infections than others, as is clear when the percentage of isolates from bacteremia related to total cases (invasive index) is calculated [7, 11]. For S. Typhimurium and S. Enteritidis, the invasive index ranges from 1 to 7% [11, 12], while for S. Dublin different reports indicate that the invasive index ranges from 50% to 70% [7, 11, 13-15]. Loss of gene function through pseudogene accumulation has been indicated as a hallmark of host-specific pathogenic bacteria as compared to their host-generalist relatives [16-22].

The Enteritidis (O: 1, 9, 12: gm: -) and Dublin (O:1, 9, 12: gp: -) serovars share antigenic properties and are phylogenetically closely related, yet they seem to differ significantly in pathogenic potential [23, 24]. S. Enteritidis commonly causes gastroenteritis but rarely causes invasive disease in humans. S. Dublin usually infects cattle causing abortion and systemic infection, but occasionally can be found infecting other hosts such as pigs and humans. On the rare occasions when it infects humans it often results in bacteraemia with severe disease and high mortality [25-27]. Characterization of the mechanisms underlying these differences is central to a more general understanding of the invasiveness of salmonellae. To date only one complete genome of a S. Enteritidis strain (P125109, hereafter referred as PT4) and two S. Dublin isolates (CT_02021853 and 3246) have been sequenced and annotated and are publicly available [28], [http://www.ncbi.nlm.nih.gov/genomeprj/19467] [29].

To gain new insights into genetic differences that could help to understand the basis of such marked different pathogenic behaviors, here we describe a comparative study between S. Enteritidis and S. Dublin. We conducted microarray-based comparative genomics between four S. Dublin clinical isolates and the core genome resulting of the comparative genome analysis of 29 S. Enteritidis isolates previously reported by us [30]. Further the pseudogene content of each serovar was also evaluated using the available genome sequences.

2. MATERIALS AND METHODS

2.1. Bacterial Strains

Twenty-nine S. enterica serovar Enteritidis isolates from diverse origins in Uruguay were previously characterized by microarray and phenotypic assays [30, 31]. Seven S. enterica serovar Dublin isolates from human infections in Uruguay were used in this study (Table 1).

Table 1..

Description of the S. Dublin Isolates Analyzed in This Work


Strain Designation Year of Isolation Origina CGHb 9 CDS Sequencec
SDU1 1995 blood + +
SDU2 2004 blood + +
SDU3 2006 blood + +
SDU4 2008 blood - +
SDU5 2000 feces + +
SDU6 2005 feces - +
SDU7 2008 feces - +

: tested.

: non-tested.

Correspond to human samples.

Comparative genomics hybridization.

Nucleotide sequence of CDS as described in text and Table 2.

Table 2..

Description of the Primers used for Amplifying and Sequencing the 9 CDS Described as Pseudogenes in S. Gallinarum, S. Dublin and S. Choleraesuis Fully Sequenced Strains


Gene in S. Enteritidis Primer Sequence (5´-3´)
SEN0042 TATTCAAAACTTGCTTAGAAAGTAGAG Forward
CGGGTCTTGTTGCATAAATGG Reverse
GGAAAGTAATGTTGTCCGCTG Reverse2
SEN0784 GTGGTAAACATATTGTAATGTTATTTTC Forward
AATGTGATTCAGGCTGTGCT Reverse
SEN2182 AGACCGGATAACGTATTTCTTTTGCC Forward
ATTCCGCCCTCTTTCAGCCAGGTC Reverse
GTGATTGTCCCGGACGACTTCTC Reverse2
SEN2493 TCCAGTTTGCTTCGTGAACG Forward
CACTGGCGATGTGACGATT Forward2
CAATTTCGGCGTAATGACGTT Forward3
ATCAACCGGTTTGTCATTCG Reverse
TACCGTCCCAGTCGCCGTTG Reverse2
SEN2783 GTGAGGTATATCAACAAAAAAGACCA Forward
TCCAGAGGCAATCCAGGA Forward2
TGTGCAGGCGCCGTTG Forward3
ACGGACGGGGAGCCAGG Reverse
CAACCTCTTTGCGTGTATCAACC Reverse2
SEN2806 GTGCTGGTAGGCGATATTAAG Forward
CTTCCCGGACGCGCGTAT Forward2
AACCTGCATTTCAGTCACTACAG Reverse
SEN3461 TTTGGCACGGCTGGCGACAT Forward
GAATGCCCTGCTGGTGGATT Forward2
CGTGCCGGGAACTATAACAG Forward3
AGCACCGACCCGCCCAACA Reverse
GCCGCGCAAACCGTAGTTCA Reverse2
SEN3672 GGCCTGGTCACGTCTGTAAC Forward
CTCTCTTTTGTCTTCGGTATCC Forward2
TATGACGGTTTGATGACAATGG Reverse
SEN4290 AACGCTTGAGGATTTAATAGAA Forward
CTGATTCAGTACCGTCAGTG Reverse
Table 3..

Regions (Reg) and Single Genes (Sing) that form the S. Enteritidis Core Genome but Appear as Absent/Divergent in S. Dublin Strains


Gene Range Homologous Function/Gene Prediction
Reg En1 SEN0083-0085 CT18, TY2, LT2, DT104, SL1344, SBG, SPA, SGAL probable secreted proteins, sulfatase
Reg En2 SEN1379-1395 (1387 present) STY (SOME) part of PHAGE SE14, ligA, B, C, D, F, ydaD
Reg En3 SEN1432-1435 SGAL ROD13 genomic island, idonate and gluconate dehydrogenase, sugar transport
Reg En4 SEN1500-SEN1506 LT2, SL1344, (CT18 and SBG some) part of ROD14 genomic island
Sing En1 SEN0196 SBG fhuA, ferrichrome iron receptor
Sing En2 SEN0281 NO safA, fimbrial subunit
Sing En3 SEN0356 SGAL putative autotransporter
Sing En4 SEN1515 CT18, TY2, LT2, DT104, SL1344, SBG, SPA, SGAL Ni/Fe-hydrogenase 1 b-type cytochrome subunit HyaC2
Sing En5 SEN1539 CT18, TY2, LT2, DT104, SL1344, SBG, SPA, SGAL dcp, dipeptidil carboxipeptidaseII
Sing En6 SEN2167 CT18, TY2, LT2, DT104, SL1344, SBG, SPA, SGAL conserved hypothetical protein
Sing En7 SEN2420 SGAL putative exported protein

CT18: S. Typhi CT18, TY2: S. Typhi Ty2, LT2: S. Typhimurium LT2, DT104: S. Typhimurium DT104, SL1344: S. Typhimurium SL1344, SBG: S. bongori, SPA: S. Paratyphi A, SGAL: S. Gallinarum.

Table 4..

Regions (Reg) and Single Genes (Sing) that are Present in all S. Dublin Strains but Absent in the S. Enteritidis Sequenced and Analyzed Isolates


Gene Range Homologous Gene Description
Reg Du1 SG1032-1044 NO clpB, Rhs proteins, conserved hypot proteins
Reg Du2a SG1182-1195 SOME SDT, SOME STY Gyfsi-2 like prophage, phage proteins and cel division inhibitor kil
Reg Du2b SG1211-1219 STM, SDT, SL Gyfsi-2 like prophage, phage proteins
Reg Du3a STY0289-0294 STM, SDT, SL, SPA, TY2, SOME GAL SPI6, hypothetical and clpB heat shock protease like protein
Reg Du3b STY0302-0310 STM, SDT, SL, SPA, TY2 SPI6, hypothetical conserved, membrane and lipoproteins
Reg Du3c STY0320-0323 STM, SDT, SL, SPA, TY2 SPI6, hypothetical and RHS proteins
Reg Du4 STY1020-1036 TY2, SOME STM, SDT, SL S. Typhi prophage 10, DNA binding and phage proteins, methyltransferase
Reg Du5 STY2043-2045 SOME SDT S. Typhi degenerate bacteriophage,putative endolysin
Reg Du6 STY3662-3671 TY2, SOME STM Phage proteins, regulatory protein CII, DNA adenine methylase
Sing Du1 SG1227 STM, SDT, SL phage tail protein
Sing Du2 SG3368 STY, STM, SDT, SL, SBG, SPA possible membrane transport protein
Sing Du3 STY0602 SDT, SBG, SPA phage integrase
Sing Du4 STY1444 TY2, STM, SDT, SL, SBG, SPA putative glycolate oxidase
Sing Du5 STY2690 TY2, STM, SDT,SL hypothetical protein
Sing Du6 STY3029 NO transposase

CT18: S. Typhi CT18, TY2: S. Typhi Ty2, LT2: S. Typhimurium LT2, DT104: S. Typhimurium DT104, SL1344: S. Typhimurium SL1344, SBG: S. bongori, SPA: S. Paratyphi A, SGAL: S. Gallinarum.

Table 5..

Distribution of the S. Enteritidis or S. Dublin Specific Pseudogenes among Different Functional Classes


Pseudogenes SEN (%)a Pseudogenes SDU (%)b
Surface 20.48 37.43
methabolism 10.84 22.91
regulatory 1.20 10.06
transposase 15.66 1.68
hypothetical 14.46 18.99
Virulence 3.61 1.12
ribosomal 0.00 1.12
Phage 26.51 1.12
Other 7.23 5.59

: distribution of the 83 S. Enteritidis specific pseudogenes.

:distribution of the 177 S. Dublin specific pseudogenes.

Table 6..

List of 21 CDS that are Predicted to be Pseudogenes in S. Dublin and S. Gallinarum but Active Genes in S. Enteritidis PT4


Gene Choleraesuis Pseu/Absenta Gene Despcription
SEN0042 YES putative transport protein
SEN0325 NO possible transmembrane regulator
SEN0621 NO putative sigma54 dependent transcriptional regulator
SEN0784 YES hypothetical protein
SEN1194 NO putative membrane transport protein
SEN1331 NO conserved hypothetical protein
SEN1335 NO putative membrane protein
SEN1524 NO putative membrane protein
SEN2173 NO putative transcriptional regulator
SEN2182b YES mglA, galactoside transport ATP binding protein
SEN2493b YES shdA, Peyer´s patch colonization and shedding factor
SEN2611 NO putative type I secretion protein, SPI9 ATP-binding protein
SEN2783 YES conserved hypothetical protein
SEN2806 YES ygcY probable glucarate dehydratase
SEN3461 YES lpfC, outer membrane usher protein
SEN3537 NO rfaZ (waaZ) LPS core biosynthesis protein
SEN3571 NO yicJ sodium galactoside family symporter
SEN3672 YES probable PTS system permease
SEN3954 NO nfi, putative endonuclease V
SEN4259 NO hypothetical protein
SEN4290 YES Type I restriction-modification system methyltransferase

YES indicates that the corresponding gene is a pseudogene or is absent in the genome of S. Choleraesuis SC-B67. NO indicates that corresponds to an active gene.

indicates that corresponds to a pseudogene in the sequences of S. Typhi CT18 and Ty2 as well as in S. Paratyphi A ATCC 9150 and S. Paratyphi A AKU_12601, as analyzed by Holt et al. [22].

Isolates were maintained frozen at -80°C in LB containing 25% glycerol. Bacteria were cultured in LB broth, or on LB containing 1.6% agar, or Tryptic Soy Agar. All isolates were identified as Salmonella enterica using standard biochemical tests and microbiological methods. Serovar was determined by the slide agglutination test for O antigen and the tube agglutination test for H antigen, using commercially available anti-O and anti-H antisera (Difco, France). Differentiation between S. Enteritidis and S. Dublin was confirmed by PCR for the detection of genetic regions specific for Enteritidis [32] and by sequencing the fliC gene, which differs between these serovars.

2.2. Comparative Genomic Hybridization Analysis (CGH)

Four S. Dublin strains were analyzed by CGH using the Salmonella generation IV microarray [30, 33, 34] with PT4 DNA [28] as reference. The array is non-redundant and contains coding sequences from the following eight genomes: S. enterica serovar Typhi (S. Typhi) CT18, S. Typhi Ty2, S. Typhimurium LT2 (ATCC 700220), S. Typhimurium DT104 (NCTC 13348), S. Typhimurium SL1344 (NCTC 13347), S. Enteritidis PT4 P125109 (NCTC 13349), S. Gallinarum 287/91 (NCTC 13346), and S. bongori 12419 (ATCC 43975). Total DNA (including plasmid DNA) was extracted from each strain using a Genome DNA extraction kit (Promega) and quantified by agarose gel electrophoresis. Labeled DNA from S. Enteritidis PT4 (control sample) and one of the query Salmonella strains (experimental sample) were mixed in equal volumes and concentrations and hybridized to the microarray slides as previously described [30]. Data were normalized to the median value, and the total list of 6,871 genes was filtered by removing those spots with a high background and those without data in at least one of the replicates (three slides per strain, duplicate features per slide). After filtering, a list of 5,695 genes was obtained that corresponded to genes that presented a valid signal in at least one of the strains analyzed. Data analysis was performed on Excel files, following criteria previously described [30].

Genes assigned as absent/divergent in all S. Dublin isolates were compared to the core genome of S. Enteritidis as defined in our previous study [30]. Genes detected as present in all S. Dublin isolates but absent in S. Enteritidis PT4 were compared with the S. Enteritidis dispensable genome as well as with the fully sequenced Salmonella isolates available in the NCBI database. Genes encoded in plasmids were not considered in this analysis.

2.3. Web Based Comparative Genomics

The sequences and annotations of the Salmonella genomes analyzed here were obtained from the data available at NCBI [http://www.ncbi.nlm.nih.gov/]. Nucleotide sequences were analyzed using the sequence visualization and annotation tool Artemis version 10 [35]. The search for homologous genes and regions was performed using Blast-n and Blast-p online at the NCBI website.

2.4. Pseudogene Screening in S. Dublin Isolates

The sequences of nine CDS detected as pseudogenes in the S. Dublin, S. Gallinarum and S. Choleraesuis sequenced strains were evaluated in all 7 S. Dublin isolates included in this work. Genomic DNA was extracted from the bacterial strains using DNeasy blood and tissue kit (Qiagen). Specific primers for amplification and sequencing were designed based on the sequences of the corresponding regions in the genomes of S. Enteritidis PT4 and S. Dublin CT_02021853 (Table 2). PCRs were conducted using a 10:1 mix, in terms of units, of Taq Polymerase and Pfu Polymerase (Fermentas) and the PCR products were sequenced. Sequences were analyzed and aligned using BioEdit Sequence Alignment editor version 7.0.9.0, 2007.

3. RESULTS

3.1. Microarray-based Comparative Genomics of S. Enteritidis and S. Dublin Isolates

The genetic content of the 4 S. Dublin isolates was evaluated by microarray and a core genome (i.e. genes present in all strains) was defined. To explore the genetic determinants underlying the phenotypic differences between S. Dublin and S. Enteritidis, we compared the core genome of S. Dublin with the previously defined core genome of S. Enteritidis [30]. We found 3771 genes shared by both serovars, whereas 33 genes were only present in S. Enteritidis strains (Table 3) and 87 genes were only present in S. Dublin isolates (Table 4). The regions of difference found by CGH analysis are similar to the regions of difference obtained from comparison of the genomes of the two sequenced strains PT4 and CT_02021853 (results not shown). From these 120 (33 + 87) genes which are exclusive of one serovar or the other, 53 are bacteriophage-encoded.

As shown in Table 3 four DNA regions and seven single genes were present only in S. Enteritidis. Region En1 (SEN083-SEN085) encodes two putative secreted proteins and one sulphatase. BLAST analysis revealed that this region has homologues in several fully sequenced serovars of Salmonella, including S. Gallinarum, S. Typhi, S. Paratyphi A, S. Paratyphi B, S. Choleraesuis, S. Typhimurium, S. Agona, S. Newport and S. Heidelberg. Region En2 (SEN1379-1395), corresponds to phage SE14 [28], that includes genes encoding for DNA nucleases and membrane proteins, and was previously postulated to be a region of difference between S. Enteritidis and all other Salmonella serovars [30, 36] . Region En3 (SEN1432-1435) corresponds to a genomic island previously described as ROD13 [28] that encodes for idonate dehydrogenase, gluconate dehydrogenase, proteins involved in sugar transport, and proteins similar to those required for hexonate uptake. This genomic island is present in the S. Gallinarum genome sequence, but is absent from all other salmonellae sequenced to date. Region En4 (SEN1500-1506) corresponds to part of another genomic region, named ROD14 [28], and encodes for a putative transcriptional regulator akin to the LacI family, and other regulatory proteins probably involved in drug efflux. This region is present in the genome sequences from various S. Typhimurium strains, but is degraded in the S. Gallinarum and PT4 genome sequences.

Six regions and six isolated genes are present only in S. Dublin (Table 4). Region Du1 comprises thirteen genes previously annotated within the genome of S. Gallinarum (SG1032-1044) which include proteins that are members of the Rhs family, Clp proteases and exported proteins. Region Du2 (SG1182-1195 and SG1211-1219) corresponds to part of the Gifsy-2-like prophage remnant present in the genome of S. Gallinarum [28]. Region Du3 corresponds to genes found in SPI-6 from S. Typhi CT18.

Regions Du4, Du5 and Du6, correspond to prophages found in the genome sequence of S. Typhi CT18 [16]. Single genes present only in S. Dublin strains include a membrane transport protein (SG3368), a putative glycolate oxidase (STY1444) and several phage-related proteins.

Microarray methodology allowed us to detect only presence or absence/divergence of genes, but not small variations in gene sequences. Considering that pseudogene accumulation has been postulated to be involved in host restriction and adaptation, we decided to compare the pseudogene content among the available genomic sequences of both serovars and then evaluate if the Uruguayan S. Dublin clinical isolates harbour a particular set of these pseudogenes.

3.2. Pseudogene Analysis

Analysis of the genomes available in the NCBI database for S. Dublin CT_02021853 and S. Enteritidis PT4 strains, show that they have 289 CDS and 111 CDS annotated as pseudogenes respectively. From the 289 S. Dublin pseudogenes, 7 have no homologues in the S. Enteritidis sequence, and 32 correspond to intergenic regions. Among the others, 38 are homologous with 29 pseudogenes in S. Enteritidis, whereas the other 212 pseudogenes in S. Dublin correspond to 177 active genes in S. Enteritidis. Conversely, there are 83 S. Enteritidis pseudogenes that appear to be functional in S. Dublin CT_02021853. We analyzed the pseudogenes specific of each serovar, and grouped them in different classes according with their homology with functional CDS (Table 5).

S. Enteritidis, S. Dublin and S. Gallinarum form a related cluster of serovars but with marked differences in host-specificity, thus we also included S. Gallinarum in the pseudogene analysis. There is a single annotated genome sequence for this serovar that contains 309 pseudogenes [28] and among them only 21 are also annotated as pseudogenes in S. Dublin but not in S. Enteritidis (Table 6). This group of CDS includes nine that are also inactive (7) or completely absent (2) in the other host-restricted serovar S. Choleraesuis [37] and are described in Table 6.

Overall, the presence of these nine pseudogenes could be regarded as potential distinguishing markers of host-restricted serovars, thus we decided to evaluate their sequences in all S. Dublin Uruguayan isolates obtained from human infections (4 strains analyzed by CGH as described above plus 3 other isolates, Table 1). We found that all 7 isolates have these 9 CDS inactivated as pseudogenes, either by the same point mutations that are present in the fully sequenced S. Dublin CT_02021853 strain (7 of the 9 CDS) or by a different deletion as is the case of the CDS homologous to SEN2493 and SEN4290. Recently the genome sequence of another S. Dublin strain (S. Dublin 3246), was publicly released (GenBank: CM001151) [29]. We found that all 9 CDS are also pseudogenes in this strain. Further, in all but one of them the inactivation is due to the same changes than in S. Dublin CT_02021853. Interestingly, the exception is the CDS corresponding to SEN4290, which possess the same deletion than the Uruguayan strains analyzed here.

DISCUSSION

S. Enteritidis and S. Dublin are two closely related serovar with marked differences in pathogenic traits and epidemiological behavior, thus it is reasonable to assume that genomic comparison between them could shed some light on the molecular basis of these differences. A single previous report described a microarray-based genome comparison [38], and here we conducted a similar analysis using a different set of field isolates and microarray chip. Further, we now report a comparison of the full genome sequences of S. Enteritidis and S. Dublin particularly looking at differences in pseudogene composition between them.

Our comparative genome hybridization study predicted 33 genes specific to S. Enteritidis and 87 specific to S. Dublin. The analysis revealed four genetic regions and seven single genes that seem to be exclusive of S. Enteritidis core genome, as well as six regions and six single genes specific for S. Dublin. These results corroborate and extend the previous report where 3 S. Dublin and 24 S. Enteritidis strains where compared [38]. This report described the same four regions specific for Enteritidis but only one of the six S. Dublin regions found by us. This particular region, that we denominated Du3, corresponds to regions B24, B25_a and B25_b as of the earlier report. Region Du3 corresponds to genes found in SPI-6 from S. Typhi CT18. This region encodes a ClpB heat-shock protease-like protein, as well as different membrane proteins and lipoproteins that belong to the T6SS encoded in this island. Interestingly, this region includes a gene in the rhs family (STY0321) that has no homologue in the CT_02021853 genome sequence.

Among the other regions specific for S. Dublin described here, Region Du1 was recently proposed to be a pathogenicity island (SPI-19) identified in S. Gallinarum, S. Dublin, S. Weltevreden and S. Agona that encodes a type-6 secretion system (T6SS) [39]. In S. Enteritidis, an internal deletion has eliminated most of the island. Region Du2, includes various bacteriophage regulatory proteins, recombinases, transposases, and structural proteins. It also includes one gene (SG1186) previously annotated as encoding a putative phage-encoded cell division inhibitor protein belonging to the kil super-family and associated with the capacity to inhibit the essential ftsZ cell-division gene [40]. ftsZ expression is altered during the intracellular phase of infection with S. enterica, a process that is independent of sulA, a known inhibitor of ftsZ [41]. Genes encoding proteins belonging to the same super-family are also present in several S. Typhi genome sequences, as well as in other enterobacteria (e.g. different STEC strains, Shigella flexneri, Shigella dysenteriae and others) as revealed by Blast-p analysis, suggesting a possible role for these proteins in pathogenesis. Regions Du1 and Du2 were not represented in the microarray used by Porwollik and collaborators [38], thus we cannot exclude that these regions were also present in the strains studied there, but simply not found because of the particular microarray used. Regions Du4, Du5 and Du6, correspond to prophages found in the genome sequence of S. Typhi CT18 [16]. Region Du4 comprises 17 genes from a lambdoid bacteriophage that include several CDS encoding for DNA binding proteins. Region Du5 includes 3 genes that are part of a degenerate bacteriophage; one of these (STY2044) encodes a putative endolysin similar to several lysozymes from E. coli and Shigella strains. Region Du6 spans 10 genes including a DNA adenine methylase (STY3667), regulatory proteins and endonucleases. These 3 regions of difference were not found in the earlier report, despite the CDS been present in the microarray. Instead, that work reported differences in other prophage-derived genes. Thus, it could that the genomes of the particular set of strains used in both studies posses different prophage composition. The analysis of Du4-Du5-Du6 in both S. Dublin sequenced isolates, revealed that regions Du5 and Du6 are very conserved in both strains whereas region Du4 is almost complete in CT_ 02021853 but incomplete and less conserved in strain 3246, supporting the hypothesis of different content in phage genes among S. Dublin isolates.

Among the seven single genes that are for the first time described here as absent in S. Dublin strains, safA (SEN0281) and dcp (SEN1539) are of special interest. safA is the first gene of the saf fimbrial operon and encodes a lipoprotein. The operon forms part of the degraded pathogenicity island SPI-6 in the S. Enteritidis chromosome. This operon is not annotated in the S. Dublin genome sequences available. However, Blast analysis revealed that this is a region highly conserved at a nucleotide level between PT4 and both S. Dublin sequenced isolates. There are several stop codons in the S. Dublin sequence homologous to safA, suggesting that this gene is in process of degradation. The fact that we cannot detect safA by CGH in the S. Dublin Uruguayan isolates may be related with this. The dcp gene encodes for dipeptidyl-carboxypeptidase II, which is highly conserved among the Enterobacteriaceae. This gene has been described previously as a frequent site for SNPs in S. Enteritidis [42], and it is absent from the CT_02021853 sequence.

Overall, the CGH analyses did not detect clear differences in genes that have been previously reported as required for virulence to explain the differences in pathogenicity of both serovars. However, the presence/absence of a gene, as detected by this methodology, does not inform about its expression, thus these results should be interpreted with caution.

The high number of pseudogenes detected in CT_02021853 suggests that this mechanism might be relevant in the process of host adaptation of this serovar, as well as in the different epidemiological and pathogenic behavior of S. Dublin when compared with S. Enteritidis. As we describe in Table 5, we observed a differential distribution of functionality amongst the CDS inactive in S. Enteritidis and S. Dublin. More than 40% of the pseudogenes specific for S. Enteritidis correspond to CDS related to phages or transposases but only 12% with those involved in metabolism and regulatory proteins. Conversely, among the pseudogenes specific for S. Dublin 33% correspond to CDS encoding proteins involved in central metabolism or regulatory proteins and 37% to CDS related to surface structures but only 3% to phages and transposases. These observations may be relevant to understand the host restriction of S. Dublin.

We found 21 CDS that appear to be active genes in the broad host-range S. Enteritidis but pseudogenes in the host-restricted S. Dublin and in the host-specific S. Gallinarum. From this set of CDS, 9 are pseudogenes as well in the other host-restricted serovar S. Cholerasuis suggesting that their inactivation could be relevant as genetic determinants of host adaptation. These nine CDS correspond to two hypothetical proteins (SEN0784 and SEN2783), one putative transport protein (SEN0042), the gene encoding the outer membrane usher protein LpfC (SEN3461), one probable phosphotransferase system permease (SEN3672), one gene encoding a putative Type I restriction modification system protein (SEN4290), and the gene encoding a probable glucarate dehydratase 2 (SEN2806 or ygcY). The other two genes that complete this list are mglA (SEN2182) and shdA (SEN2493), which are pseudogenes in S. Typhi CT18 and Ty2 as well as in S. Paratyphi A ATCC 9150 and S. Paratyphi A AKU_12601 [22]. ShdA is involved in colonization of Peyer’s patches by S. Typhimurium and in shedding of the bacteria after infection [43-45]. MglA is a galactoside transport ATP binding protein. The roles of these genes in the broad host-range of S. Enteritidis remain to be established.

All these nine CDS are pseudogenes in the seven S. Dublin clinical isolates evaluated in this work, as well as in the other fully sequenced isolate S. Dublin 3246, suggesting that the lost of their functionality is not a consequence of random mutation. Two of these 9 pseudogenes in the Uruguayan isolates have lost their functionality by mutations that are different from those seen in the sequenced strain CT_02021853 suggesting that this loose of functionality involves a process of convergent evolution.

In conclusion, our results show several genetic differences that may help to explain why such close related organisms can nevertheless behave with such marked differences. Comparison of larger numbers of field strains at full genome scale is becoming increasingly feasible, and may provide new insights into the genetic basis of host adaptation.

CONFLICT OF INTEREST

None declared.

ACKNOWLEDGMENTS

This work was jointly supported by a project grant from the Wellcome Trust (078168/Z/05/Z) and by the Central Research Committee (CSIC) of the Universidad de la República Uruguay. We like to thanks Gordon Dougan and Derek Pickard for their helpful advices.

REFERENCES

[1] de Jong B, Ekdahl K. The comparative burden of salmonellosis in the European Union member states, associated and candidate countries BMC Public Health 2006; 6: 4.
[2] Galanis E, Lo Fo Wong DM, Patrick ME, et al. Web-based surveillance and global Salmonella distribution, 2000-2002 Emerg Infect Dis 2006; 12: 381-8.
[3] Voetsch AC, Van Gilder TJ, Angulo FJ, et al. FoodNet estimate of the burden of illness caused by nontyphoidal Salmonella infections in the United States Clin Infect Dis 2004; 38(Suppl 3): S127-34.
[4] Perales I, Audicana A. Salmonella Enteritidis and eggs Lancet 1988; 2: 1133.
[5] Wells J, Butterfield J. Incidence of Salmonella on fresh fruits and vegetables affected by fungal rots orf physical injury Plant Dis 1999; 83: 722-6.
[6] Hald T, Vose D, Wegener HC, Koupeev T. A Bayesian approach to quantify the contribution of animal-food sources to human salmonellosis Risk Anal 2004; 24: 255-69.
[7] Langridge GC, Wain J, Nair S. 18 August 2008, posting date. Chapter 8.6.2.2. Invasive Salmonellosis in Humans In: A Böck, R Curtiss, III, JB Kaper, et al., Eds., EcoSal-Escherichia coli and Salmonella: Cell Mol Biol. Available from: http://www. ecosal.org
[8] Wallis TS, Barrow PA. 25 July 2005, posting date. Chapter 8.6.2.1. Salmonella epidemiology and pathogenesis in food-producing animals, EcoSal-Escherichia coli and Salmonella: In: A Böck, R Curtiss, III, JB Kaper, et al., Eds., Cell Mol Biol. Available from: http://www.ecosal.org
[9] Uzzau S, Brown DJ, Wallis T, et al. Host adapted serotypes of Salmonella enterica Epidemiol Infect 2000; 125: 229-55.
[10] Baumler AJ, Tsolis RM, Ficht TA, Adams LG. Evolution of host adaptation in Salmonella enterica Infect Immun 1998; 66: 4579-87.
[11] Jones TF, Ingram LA, Cieslak PR, et al. Salmonellosis outcomes differ substantially by serotype J Infect Dis 2008; 98: 109-4.
[12] Helms M, Simonsen J, Molbak K. Foodborne bacterial infection and hospitalization: a registry-based study Clin Infect Dis 2006; 42: 498-506.
[13] Fernandes SA, Tavechio AT, Ghilardi AC, Dias AM, Almeida IA, Melo LC. Salmonella serovars isolated from humans in Sao Paulo State, Brazil, 1996-2003 Rev Inst Med Trop Sao Paulo 2006; 48: 179-84.
[14] Vugia DJ, Samuel M, Farley MM, et al. Invasive Salmonella infections in the United States, FoodNet, 1996-1999: incidence, serotype distribution, and outcome Clin Infect Dis 2004; 38(Suppl 3): S149-56.
[15] Threlfall EJ, Hall ML, Rowe B. Salmonella bacteraemia in England and Wales, 1981-1990 J Clin Pathol 1992; 45: 34-6.
[16] Parkhill J, Dougan G, James KD, et al. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18 Nature 2001; 413: 848-52.
[17] McClelland M, Sanderson KE, Clifton SW, et al. Comparison of genome degradation in Paratyphi A and Typhi, human-restricted serovars of Salmonella enterica that cause typhoid Nat Genet 2004; 36: 1268-74.
[18] Andersson JO, Andersson SG. Genome degradation is an ongoing process in Rickettsia Mol Biol Evol 1999; 16: 1178-91.
[19] Cole ST, Eiglmeier K, Parkhill J, et al. Massive gene decay in the leprosy bacillus Nature 2001; 409: 1007-1.
[20] Parkhill J, Sebaihia M, Preston A, et al. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica Nat Genet 2003; 35: 32-40.
[21] Thomson NR, Howard S, Wren BW, et al. The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081 PLoS Genet 2006; 2: e206.
[22] Holt KE, Thomson NR, Wain J, et al. Pseudogene accumulation in the evolutionary histories of Salmonella enterica serovars Paratyphi A and Typhi BMC Genomics 2009; 10: 36.
[23] Selander RK, Smith NH, Li J, et al. Molecular evolutionary genetics of the cattle-adapted serovar Salmonella Dublin J Bacteriol 1992; 174: 3587-92.
[24] Porwollik S, Boyd EF, Choy C, et al. Characterization of Salmonella enterica subspecies I genovars by use of microarrays J Bacteriol 2004; 186: 5883-98.
[25] Blaser MJ, Feldman RA. From the centers for disease control. Salmonella bacteremia: reports to the Centers for Disease Control, 1968-1979 J Infect Dis 1981; 143: 743-6.
[26] Fierer J. Invasive Salmonella Dublin infections associated with drinking raw milk West J Med 1983; 138: 665-9.
[27] Fierer J, Guiney DG. Diverse virulence traits underlying different clinical outcomes of Salmonella infection J Clin Invest 2001; 107: 775-80.
[28] Thomson NR, Clayton DJ, Windhorst D, et al. Comparative genome analysis of Salmonella Enteritidis PT4 and Salmonella Gallinarum 287/91 provides insights into evolutionary and host adaptation pathways Genome Res 2008; 18: 1624-37.
[29] Richardson EJ, Limaye B, Inamdar H, et al. Genome sequences of Salmonella enterica serovar typhimurium, Choleraesuis, Dublin, and Gallinarum strains of well- defined virulence in food-producing animals J Bacteriol 2011; 193: 3162-.
[30] Betancor L, Yim L, Fookes M, et al. Genomic and phenotypic variation in epidemic-spanning Salmonella enterica serovar Enteritidis isolates BMC Microbiol 2009; 9: 237.
[31] Yim L, Betancor L, Martinez A, et al. Differential phenotypic diversity among epidemic-spanning Salmonella enterica serovar Enteritidis isolates from humans or animals Appl Environ Microbiol 2010; 76: 6812-20.
[32] Herrera-Leon S, McQuiston JR, Usera MA, Fields PI, Garaizar J, Echeita MA. Multiplex PCR for distinguishing the most common phase-1 flagellar antigens of Salmonella spp J Clin Microbiol 2004; 42: 2581-6.
[33] Anjum MF, Marooney C, Fookes M, et al. Identification of core and variable components of the Salmonella enterica subspecies I genome by microarray Infect Immun 2005; 73: 7894-905.
[34] Cooke FJ, Wain J, Fookes M, et al. Prophage sequences defining hot spots of genome variation in Salmonella enterica serovar Typhimurium can be used to discriminate between field isolates J Clin Microbiol 2007; 45: 2590-8.
[35] Rutherford K, Parkhill J, Crook J, et al. Artemis: sequence visualization and annotation Bioinformatics 2000; 16: 944-5.
[36] Agron PG, Walker RL, Kinde H, et al. Identification by subtractive hybridization of sequences specific for Salmonella enterica serovar Enteritidis Appl Environ Microbiol 2001; 67: 4984-91.
[37] Chiu CH, Tang P, Chu C, et al. The genome sequence of Salmonella enterica serovar Choleraesuis, a highly invasive and resistant zoonotic pathogen Nucleic Acids Res 2005; 33: 1690-8.
[38] Porwollik S, Santiviago CA, Cheng P, Florea L, Jackson S, McClelland M. Differences in gene content between Salmonella enterica serovar Enteritidis isolates and comparison to closely related serovars Gallinarum and Dublin J Bacteriol 2005; 187: 6545-55.
[39] Blondel CJ, Jimenez JC, Contreras I, Santiviago CA. Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems differentially distributed in Salmonella serotypes BMC Genomics 2009; 10: 354.
[40] Conter A, Bouche JP, Dassain M. Identification of a new inhibitor of essential division gene ftsZ as the kil gene of defective prophage Rac J Bacteriol 1996; 178: 5100-4.
[41] Henry T, Garcia-Del Portillo F, Gorvel JP. Identification of Salmonella functions critical for bacterial cell division within eukaryotic cells Mol Microbiol 2005; 56: 252-67.
[42] Guard J. Evolutionary trends in two strains of Salmonella enterica subsp. I serovar Enteritidis PT13a that vary in virulence potential. Journal [serial on the Internet] Date: Available from: http://www.ncbi.nlm.nih.gov/genomes/static/Salmonella_SNPS.html 2010 .
[43] Kingsley RA, van Amsterdam K, Kramer N, Baumler AJ. The shdA gene is restricted to serotypes of Salmonella enterica subspecies I and contributes to efficient and prolonged fecal shedding Infect Immun 2000; 68: 2720-7.
[44] Kingsley RA, Santos RL, Keestra AM, Adams LG, Baumler AJ. Salmonella enterica serotype Typhimurium ShdA is an outer membrane fibronectin-binding protein that is expressed in the intestine Mol Microbiol 2002; 43: 895-905.
[45] Kingsley RA, Abi Ghanem D, Puebla-Osorio N, Keestra AM, Berghman L, Baumler AJ. Fibronectin binding to the Salmonella enterica serotype Typhimurium ShdA autotransporter protein is inhibited by a monoclonal antibody recognizing the A3 repeat J Bacteriol 2004; 186: 4931-9.