Study of Antifungal Susceptibility, Virulence Genes and Biofilm Formation in Candida albicans

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Study of Antifungal Susceptibility, Virulence Genes and Biofilm Formation in Candida albicans

Raghdaa Shrief1 Maysaa El Sayed Zaki2 , * Open Modal Eman Mousa El-Sehsah1 Sara Ghaleb2 Mohamed Mofreh2
Authors Info & Affiliations
The Open Microbiology Journal • 30 Sep 2019 • RESEARCH ARTICLE • DOI: 10.2174/1874285801913010241

Abstract

Background:

Candida albicans has emerged as an important nosocomial pathogen. The morbidity and mortality associated with this pathogen are related to the presence of virulence genes and antifungal resistance. The objective of the present study was to investigate the prevalence of antifungal resistance, biofilm formation and some virulence genes such as ALS1, PLB1, INT1, SAP1 and HWP1, among clinical isolates of Candida albicans recovered from immunocompromised patients.

Methods:

The study included one hundred C. albicans isolates identified phenotypically and by a molecular technique using Polymerase Chain Reaction (PCR). The identified C. albicans was further subjected to antifungal study by the microdilution method, biofilm study and molecular study for virulence genes by PCR.

Results:

The resistance to antifungal drugs, fluconazole, caspofungin and itraconazole was 8% for each of them and for amphotericin B, it was 9%. The prevalence of the studied virulence genes was HWP1 77%, INT1 72%, ALS1 65%, SAP1 65% and PLB1 52%. The biofilm capacity was identified by the microplate method in 58% of C. albicans. The OD was intense in 20 isolates, moderate in 21 isolates and mild in 17 isolates. There was a statistically significant increase in the prevalence of the studied virulence genes INT1, ALS1, HWP1, SAP1 and PLB1 among biofilm forming C. albicans as compared to non-biofilm forming isolates (P=0.0001). Additionally, the resistance to fluconazole, itraconazole and caspofungin was statistically, significantly higher in C. albicans with the capacity to form biofilm as compared to non-biofilm forming C. albicans.

Conclusion:

The present study highlights the prevalence of resistance to antifungal drugs among C. albicans which are not uncommon. Moreover, there was a high prevalence of INT1, ALS1, HWP1, SAP1 and PLB1 genes in C. albicans. The resistance to antifungal drugs was common among isolates with the capacity to form the biofilm. There was an association between the biofilm formation and virulence genes.

Keywords: C. albicans, Virulence genes, Biofilm, Antifungal resistance, Morbidity, Microdilution method.

1. INTRODUCTION

Candida genus is a polymorphic diploid fungus and considered a part of human microbiota [1]. However, in certain pathogenic conditions, it can be a leading cause of infection either in superficial infections of skin and mucous membranes or systemic invasive infections. Candida species are the fourth cause of nosocomial bloodstream infections with a mortality rate of up to 40% [2, 3].

There are several Candida species such as Candida albicans (C. albicans), Candida glabrata, Candida tropicalis, and Candida parapsilosis, but C. albicans remains the most frequent species isolated from bloodstream infections [4].

There are several predisposing factors for invasive infections with Candida species as the presence of patient’s immunocompromised conditions [5], physical alteration of the normal barrier such as surgery and overgrowth of Candida species after broad-spectrum antibiotics intake with the reduction of normal bacterial microbiota [6]. Early laboratory diagnosis of Candida invasive infections reduces the mortality rate from 40% to 15% after the start of appropriate antifungal therapy [7].

Several pathogenic virulence factors are encoded by C. albicans genes and assist the fungus to invade the host tissues leading to infections. Among these virulence factors are the capacity of C. albicans to change from the budding yeast form to filamentous form, the expression of adhesion factors, the ability to form biofilm and the secretion of hydrolytic enzymes [8].

In C. albicans, the adhesion and biofilm formation are supposed to be mediated through the hyphal wall protein 1(Hwp1) located on the surface of the hyphae [9]. The gene encoding Hwp1 is part of a core of eight genes induced during filamentation of C. albicans [10]. The adhesion of C. albicans is also mediated by agglutinin-like sequence 1 gene (ALS1) that mediates attachment to endothelial cells. It is also important for hyphal formation as well as adherence [11]. There are two genes with similar sequences and functions, ALS1 and ALS3 [12].

Additionally, the phospholipases protein 1 (PLB1 p) facilitates the invasion of Candida albicans through gastrointestinal tract leading to systemic infection [13]. Hydrolysis of peptide bonds of the host proteins is mediated by the secreted aspartyl proteinases (Saps), suggested to be involved in the virulence of Candida albicans [14]. The INT1 gene is a virulence factor that contributes to the ability of Candida albicans to adhere to epithelial cells and form hyphae [15, 16].

The presence of virulence genes and the increasing prevalence of resistance to antifungal therapy have contributed to the pathogenicity of Candida albicans. Nevertheless, the association between the resistance profiles and virulence genes of C. albicans has not been studied sufficiently [17], especially in invasive C. albicans infections.

The objective of the present study was to investigate the prevalence of antifungal resistance, biofilm formation and some virulence genes, such as ALS1, PLB1, INT1, SAP1 and HWP1 among clinical isolates of C. albicans.

2. MATERIALS AND METHODS

This study included one hundred Candida albicans isolates from patients with nosocomial infections under chemotherapy for the treatment of malignancies admitted to intensive care units of Mansoura Oncology Centre, Mansoura city, Egypt during March 2017 till January 2019. The healthcare-associated infections were actively identified by the National Surveillance System supported by Supreme Council of Egyptian Universities in cooperation with Center of Disease Control. The study was approved by the Mansoura Faculty of Medicine Ethical Committee and approvals were obtained from the participating patients.

2.1. Samples and their Processing

The study samples were ten-milliliter blood samples obtained from each patient under complete antiseptic conditions and inoculated to two blood cultures for fungal culture, Mycosis-IC/F blood culture bottles. Urine samples were obtained as mid-stream urine sample in sterile container or from the catheter by sterile syringe from the sampling port on the catheter bag.

The isolated C. albicans was recovered from 56 blood cultures using BACTEC 9240 system and Mycosis-IC/F blood culture (Becton Dickinson Diagnostics-Heidelberg Germany). In addition, 44 isolates were recovered from urine cultures on Sabouraud dextrose media (Oxoid, Hampshire RG24 8PW, United Kingdom) with colony counts > 105 colony forming units/ml.

Phenotypic identification of C. albicans was performed by API20C biochemical reaction, the ability to form germ tube, the use of positive growth on hypertonic Sabouraud broth and colony character on the culture of tobacco agar media. Further molecular identification was carried out through a molecular method by the use of Polymerase Chain Reaction (PCR). The identified C. albicans was further subjected to antifungal study by microdilution method, biofilm study and molecular study for virulence genes by PCR.

2.2. Phenotypic Identification of Candida albicans

2.2.1. Growth on Hypertonic Sabouraud Broth.

Hypertonic Sabouraud broth was inoculated with the isolated colonies from Sabouraud dextrose agar and incubated at 28˚C for 96 hours with a daily check for growth. Positive Candida growth indicated C. albicans species [18]. C. albicans (ATCC No. 90028) was used as a positive quality control strain.

2.2.2. Growth on Tobacco Agar

The subculture of the isolated Candida species was performed on Tobacco agar and the plates were incubated for 96 hours at 28˚C with a daily check for growth. White creamy smooth growth was identified as C. albicans [19].

2.2.3. Biofilm Study

Pure C. albicans colonies were cultured on Sabouraud broth at 28oC with a continuous shake for 18 hours. Then a suspension was prepared from C. albicans using RPMI 1640 at the concentration of 106/ml and 100 μl of the suspension was inoculated into a 96-well microtiter plate in triplicate. Then the plate was incubated at 37oC for 48 hours. Negative control wells were inoculated with RPMI 1640 without C. albicans. Each well was then washed with 200 μl phosphate buffer, air-dried and stained with 110 μl 0.4% crystal violet solution for 45 min. Subsequently, each well was washed four times with 350 μl sterile distilled water then 200 μl of 95% ethanol was added and left for 45 min. After that, 100 μl of the solution in each well was transferred to a new well and the optical density was measured with a microplate reader (Stat Fax 2100) at 595 nm. The absorbance values for the controls were subtracted from the values for the test wells [20].

Four biofilm density categories were used to grade the biofilms based on the established optical density cut-off values (ODc), which were derived from the mean values of negative controls (mean ODnc) summed with three standard deviations of the negative controls (3 × SDnc): ODc = mean ODnc + (3 × SDnc). The biofilm density categories used are as follows: OD ≤ ODC = biofilm negative, ODC < OD ≤ 2 x ODC = mildly positive for biofilm, 2 x ODC < OD ≤ 4 x ODC = moderately positive for biofilm, OD > 4 x ODC = intensely positive for biofilm [21].

2.2.4. Minimum Inhibitory Concentration (MIC) determination for C. albicans

The susceptibility of the isolated C. albicans to amphotericin B, fluconazole, itraconazole and caspofungin was determined by the microdilution method. The minimum inhibitory concentrations were determined by the broth microdilution method as described by the Clinical and Laboratory Standards Institute [22]. C. parapsilosis ATCC 22019 and C. krusei ATCC 6258 were included as quality controls for each test performed.

2.3. Molecular Study for the Isolated C. albicans

2.3.1. DNA Extraction for Fungi

DNA was extracted from the isolated C. albicans using Qiagen DNA extraction kit according to the recommendations of the manufacturer (Qiagen-Germany).

2.3.2. Identification of C. albicans

Extracted DNA was amplified by specific primers for C. albicans. The used primers are listed in Table 1. The amplification procedures were as described previously [23].

2.3.3. Detection of Virulence Gene Markers by PCR

Extracted DNA was used for amplification of HWP1, ALS1, αINT1, SAP1 and PLB1 virulence genes. The genes and the sequences of the used primers are listed in Table 1. The amplification procedures for each of the studied genes were as described previously and the used amplification mixtures were from Qiagen in addition to 2.5 μl of each primer and 5 μl of the extracted DNA [23]. The PCR amplification products were visualized by electrophoresis on 1% agarose gels for 45 min at 70v. The size of the amplicons was determined by comparison to the 100 bp DNA ladder (Promega, USA).

Table 1.
The sequences of the primers used for molecular study of the isolated C. albicans by PCR and size of amplicons (Base Pair (bp)).
Gene Sequence of Primers Size of Amplicon (bp)
CALB1 FP/TTTATCAACTTGTTGTCACACCAGA
RP/ATCCCGCCTTACCACTACCG		 273
HWP1 FP/ATGACTCCAGCTGGTTC
RP/TAGAT CAAGAATGCAGC		 572
ALS1 FP/GACTAGGAACAACAAATACCAGA
RP/CCAGAAGAAACAGCAGGTGA		 318
INT1 FP/AAGCTCTGATACCTACACTAGCGA
RP/GTTAGGTCTAAAGTCGAAGTCATC		 239
SAP1 FP/GCTCTTGCTATTGCTTTATTA
RP/CATCAGGAACCCATAAATCAG		 253
PLB1 FP/ATGATTTTGCATCATTTG
RP/AGTATCTGGAGCTCTAC		 751

2.4. Statistical Analysis

The data was analyzed by SSPS 22. The qualitative data were expressed as counts and percentage. The comparison was performed by Chi-Square test and P was significant if its value was less than 0.05.

3. RESULTS

This study included 100 C. albicans isolates that were identified by phenotypic and molecular methods using a specific gene by PCR. The isolates were isolated from nosocomial infections of 56 patients with sepsis and 44 patients with urinary tract infections.

The resistance of the isolated C. albicans to antifungal drugs, fluconazole, caspofungin and itraconazole was 8% for each of them and 9% for amphotericin B (Table 2) using the microdilution method.

Table 2.
Antifungal resistance of 100 C. albicans isolates using the microdilution method.
Antifungal No. %
Fluconazole 8 8%
Amphotericin B 9 9%
Caspofungin 8 8%
Itraconazole 8 8%

The prevalence of the studied virulence genes in C. albicans isolates was HWP1 77%, INT1 72%, ALS1 65%, SAP1 65% and PLB1 52% using PCR (Table 3, Fig. 1).

Table 3.
Prevalence of the studied virulence genes in the 100 C. albicans isolates using PCR.
Genes Frequency %
HWP1 77 77%
INT1 72 72%
ALS1 65 65%
SAP1 65 65%
PLB1 52 52%

The biofilm capacity was identified by the microplate method in 58% of C. albicans isolates. The OD was intense in 20 isolates, moderate in 21 isolates and mild in 17 isolates. The optical density of all isolates is summarized in Figs. 2, 3.

The resistance to the tested antifungal drugs increased in C. albicans with the capacity to form biofilm as compared to non-biofilm forming C. albican; this increase for fluconazole was 12.1% in biofilm forming C. albicans versus non biofilm forming isolates (2.4%), itraconazole (12.1%) in biofilm forming C. albicans versus non biofilm forming isolates (2.4%), amphotericin B (13.8%) in biofilm forming C. albicans versus non biofilm forming isolates (2.4%) and caspofungin (12.1%) in biofilm forming C. albicans versus non biofilm forming isolates (2.4%), (Table 4). Additionally, there was a statistically significantly high prevalence of the studied virulence genes, INT1, ALS1, HWP1, SAP1 and PLB1 (98.3%, 96.6%, 96.6%, 96.6%, and 81.03%, respectively) among biofilm forming C. albicans as compared to non-biofilm forming isolates (35.7%, 21.4%, 50%, 21.4%, and 11.9%, respectively), P=0.0001, (Table 4).

Table 4.
Comparison between biofilm forming C. albicans and non-biofilm forming C. albicans.
– Biofilm forming
C. albicans
(No = 58)
No. % 		Non-biofilm forming C. albicans (No = 42)
No. % 		P
Sepsis
Urine 		33 56.9%
25 43.1%		 23 54.8%
19 45.2%		 P = 0.5
Fluconazole resistance 7 12.1% 1 2.4% P = 0.1
Itraconazole resistance 7 12.1% 1 2.4% P = 0.1
Amphotericin B resistance 8 13.8% 1 2.4% P = 0.05
Caspofungin resistance 7 12.1% 1 2.4% P = 0.1
INT1 57 98.3% 15 35.7% P = 0.0001
ALS1 56 96.6% 9 21.4% P = 0.0001
HWP1 56 96.6% 21 50% P = 0.0001
SAP1 56 96.6% 9 21.4% P = 0.0001
PLB1 47 81.03% 5 11.9% P = 0.0001

4. DISCUSSION

In the last few years, Candida species particularly C. albicans has emerged as an important nosocomial pathogen [24]. The differentiation between different Candida species depends mainly upon the biochemical identification, germ tube formation and the specific culture appearance on specific media [25].

(1a). Positive PCR for CLA1 gene, M: marker, lanes 1,2,3,4 positive PCR for CLA1 genes.
(1b). Positive PCR for HWP1gene, M: marker, lanes 1,2 positive PCR for HWP1 genes.
(1c). PCR for ALS1 gene M; marker, lanes 1,3 positive PCR, lane 2 negative PCR.
(1d). PCR positive for INTL1 gene M; marker, lanes 1,2 positive PCR.
(1e). PCR positive for SAP1 gene M; marker, lanes 1,2 positive PCR.
(1f). PCR positive for PLB1 gene M; marker, lanes 1,2 positive PCR.

Fig. (1) Detection of different studied genes in the isolated C. albicans by PCR.
Fig. (2). Biofilm assay for C. albicans isolates using 96-well microtiter plate method.
B: blank, Wells 1, 2: strong positive, Well 3: weak positive, Well 4: intermediates positive.
Fig. (3). Optical density of biofilm formation by all isolated C. albicans.

Similarly, in the present study, the identification of Candida albicans was performed by the biochemical reactions, germ tube and culture characters on specific media. Moreover, molecular identification was used to confirm the species of C. albicans. The primers used in the molecular identification were designed based on the sequence data for the Internal Transcribed Spacer (ITS) region-specific for C. albicans as shown previously [26].

The azoles are used for the treatment of fungal infections. These compounds exert their effects through the inhibition of ergosterol biosynthesis in the fatty cell membranes [27]. On the other hand, the antifungal effects of amphotericin B are directed through sequestration of ergosterol in the fungal cell membranes leading to its death and also through accumulation of reactive oxygen species which has been associated with cell damage, apoptosis induction and death [28].

In our study, the resistance to antifungal drugs, fluconazole, caspofungin and itraconazole was 8% for each of them and 9% for amphotericin B. The resistance of Candida species to different antifungal drugs either azoles or amphotericin B varied in different studies from 2.8% up to 80% [24, 29, 30]. Cross-resistance should be considered for some antifungal agents from the azole family [31]. The existing difference may be due to population or regional studies. Moreover, fluconazole in some immunocompromised patients was used as prophylaxis, which can explain the differences in resistance rates in some populations. Therefore, the present study highlights the importance to incorporate the antifungal susceptibility tests as a routine laboratory test for the management of systemic infection by C. albicans.

In the present work, the prevalence of the studied virulence genes was HWP1 77%, INT1 72%, ALS1 65%, SAP1 65% and PLB1 52%. A previous study revealed higher frequency for INT1, ALS1 (100%) and HWP1 (90.9%) with lower frequency of SAP1 (59.09%) and PLB1 (13.63%) [23]. Different prevalence rates for the virulence genes have been reported in the literature ranging from 5% to 100% [32, 33]. The difference in the prevalence rates of virulence genes may be attributed to several factors including the number of isolates studied and the difference of the isolation sites of C. albicans.

The biofilm capacity was identified by the microplate method in 58% of C. albicans. The OD was intense in 20 isolates, moderate in 21 isolates and mild in 17 isolates. The frequency of biofilm formation among isolated C. albicans from immunocompromised patients is similar to the previous study by Vijayalakshmi et al. [25], but higher than other work by Tumbarello et al. [34]. The difference in the frequency of biofilm formation may be attributed to the different in vitro study of biofilm formation. In the present work, the used method was the microplate method with the initial removal of non-adherent C. albicans as the standard method advised [35]. Considering the biofilm-forming capacity of these C. albicans isolates, their pathogenicity could result in severe co-infection with other diseases.

In the present study, there was a high prevalence of antifungal resistance to azoles, amphotericin B and caspofungin in biofilm forming C. albicans. This finding is in line with previous studies [25, 36]. This association between biofilm formation and antifungal resistance may be attributed to several mechanisms such as limited penetration of drug through biofilm matrix, decrease in the rate of C. albicans, need for nutrition and its persistence and increase in rate of the expression of resistance genes induced by contact with a surface and persistence of a small number of cells. The association between the capacity of C. albicans to form biofilm with the presence of resistance to antifungal drugs renders its treatment difficult and necessitates different lines of treatment [37].

This study revealed the statistically significant increase in the prevalence of the studied virulence genes, INT1, ALS1, HWP1, SAP1 and PLB1 among biofilm-forming C. albicans as compared to non-biofilm forming isolates. This was due to the hypothesis that adhesion of C. albicans at the initial step of the biofilm formation involves different virulence factors encoded by virulence genes such as Als proteins [35] and Hwp1 [38, 39], all of which are expressed at much higher levels in hyphae than in yeast cells [37].

Thus, the present study revealed significant association between the virulence genes, antifungal resistance and biofilm formation among C. albicans associated with nosocomial infections

CONCLUSION

The present study highlights the prevalence of resistance to antifungal drugs among C. albicans, which are not uncommon. Moreover, there is a high prevalence of INT1, ALS1, HWP1, SAP1 and PLB1 genes in C. albicans. The resistance to antifungal drugs is common among C. albicans isolates with a capacity to form a biofilm. Additionally, there is an association between biofilm formation and virulence genes.

LIST OF ABBREVIATIONS

C. albicans = Candida albicans
PCR = Polymerase Chain Reaction
OD = Optical Density
MIC = Minimum Inhibitory Concentration
Bp = Base Pair

AUTHORS CONTRIBUTIONS

All authors have contributed to the manuscript.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The study was approved by the Mansoura Faculty of Medicine Ethical Committee, Egypt.

HUMAN AND ANIMAL RIGHTS

No animals/humans were used for studies that are the basis of this research.

CONSENT FOR PUBLICATION

Informed consent was obtained from all the participants.

AVAILABILITY OF DATA AND MATERIALS

All data generated or analyzed throughout this research are included in this published article.

FUNDING

None.

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

The authors would like to thank all support staff and participating patients in this study.

REFERENCES

1
Gow NA, van de Veerdonk FL, Brown AJ, Netea MG. Candida albicans morphogenesis and host defence: Discriminating invasion from colonization. Nat Rev Microbiol 2011; 10(2): 112-22.
2
Karacaer Z, Oncul O, Turhan V, Gorenek L, Ozyurt M. A surveillance of nosocomial candida infections: Epidemiology and influences on mortalty in intensive care units. Pan Afr Med J 2014; 19: 398-4960.
3
Pfaller MA, Diekema DJ. Epidemiology of invasive mycoses in North America. Crit Rev Microbiol 2010; 36(1): 1-53.
4
Williams DW, Jordan RP, Wei XQ, et al. Interactions of Candida albicans with host epithelial surfaces. J Oral Microbiol 2013; 5: 5.
5
Spellberg B. Novel insights into disseminated candidiasis: Pathogenesis research and clinical experience converge. PLoS Pathog 2008; 4(2)e38
6
van de Veerdonk FL, Kullberg BJ, Netea MG. Pathogenesis of invasive candidiasis. Curr Opin Crit Care 2010; 16(5): 453-9.
7
Kaur H, Chakrabarti A. Strategies to reduce mortality in adult and neonatal candidemia in developing countries. J Fungi (Basel) 2017; 3(3): 41.
8
Galocha M, Pais P, Cavalheiro M, Pereira D, Viana R, Teixeira MC. Divergent approaches to virulence in C. albicans and C. glabrata: Two sides of the same coin. Int J Mol Sci 2019; 20(9): 2345.
9
Sundstrom P, Balish E, Allen CM. Essential role of the Candida albicans transglutaminase substrate, hyphal wall protein 1, in lethal oroesophageal candidiasis in immunodeficient mice. J Infect Dis 2002; 185(4): 521-30.
10
Martin R, Albrecht-Eckardt D, Brunke S, Hube B, Hünniger K, Kurzai O. A core filamentation response network in Candida albicans is restricted to eight genes. PLoS One 2013; 8(3)e58613
11
Fu Y, Ibrahim AS, Sheppard DC, et al. Candida albicans Als1p: An adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol Microbiol 2002; 44(1): 61-72.
12
Nobile CJ, Schneider HA, Nett JE, et al. Complementary adhesin function in C. albicans biofilm formation. Curr Biol 2008; 18(14): 1017-24.
13
Samaranayake YH, Dassanayake RS, Jayatilake JAMS, et al. Phospholipase B enzyme expression is not associated with other virulence attributes in Candida albicans isolates from patients with human immunodeficiency virus infection. J Med Microbiol 2005; 54(Pt 6): 583-93.
14
Naglik JR, Challacombe SJ, Hube B. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol Mol Biol Rev 2003; 67(3): 400-28.
15
Asleson CM, Bensen ES, Gale CA, Melms AS, Kurischko C, Berman J. Candida albicans INT1-induced filamentation in Saccharomyces cerevisiae depends on Sla2p. Mol Cell Biol 2001; 21(4): 1272-84.
16
Hostetter MK, Gale CA, Bendel CM, Tao NJ. DNA encoding-Candida albicans integrin-like protein United States Patent 2002. 6346411.
17
El-Houssaini HH, Elnabawy OM, Nasser HA, Elkhatib WF. Correlation between antifungal resistance and virulence factors in Candida albicans recovered from vaginal specimens. Microb Pathog 2019; 128: 13-9.
18
Alves SH, Milan EP, de Laet Sant’Ana P, Oliveira LO, Santurio JM, Colombo AL. Hypertonic sabouraud broth as a simple and powerful test for Candida dubliniensis screening. Diagn Microbiol Infect Dis 2002; 43(1): 85-6.
19
Khan ZU, Ahmad S, Mokaddas E, Chandy R. Tobacco agar, a new medium for differentiating Candida dubliniensis from Candida albicans. J Clin Microbiol 2004; 42(10): 4796-8.
20
Jin Y, Yip HK, Samaranayake YH, Yau JY, Samaranayake LP. Biofilm-forming ability of Candida albicans is unlikely to contribute to high levels of oral yeast carriage in cases of human immunodeficiency virus infection. J Clin Microbiol 2003; 41(7): 2961-7.
21
Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J Microbiol Methods 2000; 40(2): 175-9.
22
Clinical and laboratory standards institute. reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard M27-A3. 2008.
23
Abdul-Lateef LA-R. AL- Kafhaji KA, Al-Saddam ASK. Genetic identification of some virulence factors of Candida albicans in candidal intertrigo of diabetic patients in Hilla Province/ Iraq. AJBAS 2015; 9: 66-72.
24
Cox GM, Perfect JR. Fungal infections. Curr Opin Infect Dis 1993; 6: 422-6.
25
Vijayalakshmi P, Thenmozhi S, Rajeswari P. The Evaluation of the virulence factors of clinical Candida isolates and the anti-biofilm activity of Elettaria cardamomum against multi-drug resistant Candida albicans. Curr Med Mycol 2016; 2(2): 8-15.
26
Luo G, Mitchell TG. Rapid identification of pathogenic fungi directly from cultures by using multiplex PCR. J Clin Microbiol 2002; 40(8): 2860-5.
27
Wynn RL, Jabra-Rizk MA, Meiller TF. Fungal drug resistance, biofilms, and new antifungals. Gen Dent 2003; 51(2): 94-8.
28
Mesa-Arango AC, Rueda C, Román E, et al. Cell wall changes in amphotericin B-resistant strains from Candida tropicalis and relationship with the immune responses elicited by the host. Antimicrob Agents Chemother 2016; 60(4): 2326-35.
29
Jabra-Rizk MA, Falkler WA, Meiller TF. Fungal biofilms and drug resistance. Emerg Infect Dis 2004; 10(1): 14-9.
30
Dos Santos Abrantes PM, McArthur CP, Africa CW. Multi-drug resistant oral Candida species isolated from HIV-positive patients in South Africa and Cameroon. Diagn Microbiol Infect Dis 2014; 79(2): 222-7.
31
Badiee P, Badali H, Diba K, et al. Susceptibility pattern of Candida albicans isolated from Iranian patients to antifungal agents. Curr Med Mycol 2016; 2(1): 24-9.
32
Inci M, Atalay MA, Ozer B, Evirgen O, Duran N, Motor VK, et al. Investigations of ALS1 and HWP1 genes in clinical isolates of Candida albicans. Turk J Med Sci 2013; 43: 125-30.
33
Ali AS, Al-Attraqhchi AAF, Al-Ahmar SD. Molecular detection of ALS1 virulence gene of Candida albicans isolated from groups of Iraq patients. J Fac Med Baghdad 2014; 57: 79-83.
34
Tumbarello M, Posteraro B, Trecarichi EM, et al. Biofilm production by Candida species and inadequate antifungal therapy as predictors of mortality for patients with candidemia. J Clin Microbiol 2007; 45(6): 1843-50.
35
Hoyer LL, Green CB, Oh SH, Zhao X. Discovering the secrets of the Candida albicans Agglutinin-Like Sequence (ALS) gene family--a sticky pursuit. Med Mycol 2008; 46(1): 1-15.
36
Jabra-Rizk MA, Falkler WA, Meiller TF. Fungal biofilms and drug resistance. Emerg Infect Dis 2004; 10(1): 14-9.
37
Bhatt M, Sarangi G, Paty BP, et al. Biofilm as a virulence marker in Candida species in Nosocomial blood stream infection and its correlation with antifungal resistance. Indian J Med Microbiol 2015; 33(Suppl.): 112-4.
38
Staab JF, Bradway SD, Fidel PL, Sundstrom P. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 1999; 283(5407): 1535-8.
39
Nobile CJ, Nett JE, Andes DR, Mitchell AP. Function of Candida albicans adhesin Hwp1 in biofilm formation. Eukaryot Cell 2006; 5(10): 1604-10.