Estimation of Biofilm Components and Prevalence of SDR Genes among Staphylococcus Aureus Isolated from Anbar Hospitals

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Estimation of Biofilm Components and Prevalence of SDR Genes among Staphylococcus Aureus Isolated from Anbar Hospitals

The Open Microbiology Journal • 15 Nov 2024 • RESEARCH ARTICLE • DOI: 10.2174/0118742858349916241111100231

Abstract

Background

Nosocomial infections, a major health problem, are due at 80% to biofilm‐associated infection. Staphylococcus aureus, a prominent biofilm producer, has both MRSA and MSSA biofilm-forming capabilities that highlight its persistence in hospital environments. In previous studies, less focus was given to the components of the biofilms. Therefore, understanding biofilm composition has become crucial.

Objective

In this study, the components in the biofilm matrix in MRSA and MSSA isolates were estimated, and the prevalence of sdr genes (sdrC,sdrD,sdrE) among S. aureus strains was investigated.

Methods

Between September, 2023 and January, 2024, a total of 200 specimens were collected from patients with suspected Staphylococcus aureus infections. Eighty-two isolates were identified as S. aureus from various sources, including wounds, nasal swabs, ear swabs, and blood, based on macroscopic, microscopic, and molecular properties. Biofilms were subjected to DNase and proteinase K treatment in order to identify their biochemical composition. Multiplex PCR was used to determine the distribution of sdr genes among isolates.

Results

The average reduction after treatment with proteinase K in MSSA biofilms (29.67±16.62) was significantly lower than in MRSA biofilms (46.21±26.33, p=0.032). Also, when treated with DNase, MRSA biofilms showed a greater average reduction (49.65±25.30) compared to MSSA biofilms (28.71±20.98, p=0.006). MRSA and MSSA biofilms also had different polysaccharide concentrations, with MSSA biofilms having significantly higher levels (206.86±82.92 μM/OD595) than MRSA biofilms (85.80±32.52 μM/OD595, p=0.005). The sdrC gene was most common in the gene profiles of MRSA (100%) and MSSA (50%). There was a strong association between the presence of the sdrD gene and methicillin-resistant S. aureus isolates (p < 0.001).

Conclusion

These findings indicate that the biofilms of MRSA isolates are largely composed of proteins and eDNA, while MSSA isolates rely on polysaccharides in their biofilms. The results indicate the importance of proteins encoded by SDR genes in the development of biofilm structure.

Keywords: Biofilms, MSCRAMM, Sdr genes, Serine-aspartate repeat proteins, Staphylococcus aureus, Nosocomial infections.

1. INTRODUCTION

Staphylococcus aureus is an opportunistic pathogen that can lead to several self-limiting, even life-threatening dis- eases in humans [1]. S. aureus continues to be a significant contributor to hospital-acquired infections, even with the use of antibiotics and advancements in medical treatment [2].

One of the main reasons S. aureus infections are particularly problematic is the biofilm formation [3]. Biofilms are bacterial communities that produce a robust extracellular matrix of eDNA, protein, and poly- saccharides, serving as their first line of self-protection [4]. Currently, researchers generally believe that more than 80% of chronic infections are mediated by bacterial biofilms [5]. Attachment to human matrix proteins is the initial stage of biofilm formation [6]. S. aureus expresses numerous MSCRAMMs (microbial surface components recognizing adhesive matrix molecules) capable of binding to proteins like fibrinogen or fibronectin and often binding to multiple types of matrix proteins [6].

S. aureus carries genes called sdrC, sdrD, and sdrE. These genes are sited together in a specific region of its DNA known as the sdr locus. They code for proteins named serine-aspartate repeat proteins (sdr). The sdr proteins are members of the MSCRAMM family, of approximately 2.8, 3.9, and 3.5 kbp, respectively, located in the sdr locus. sdr proteins are not closely related, with only 20 to 30% identical amino acid residues, indicating that different sdr proteins have different roles in S. aureus pathogenicity [7]. The function of sdr proteins in S. aureus remains unknown. However, there have been a few studies that reported a strong correlation between sdr genes of S. aureus and certain human diseases according to the distributional assay of sdr genes [8]. These Sdr proteins are found on the surface of the bacteria and have a unique feature: a region rich in serine-aspartate pairs encoded by the variable number of repeats within the sdr genes [9]. This self-association of the serine-aspartate repeat protein sdr promotes both bacterial adherence to surfaces and biofilm formation [10]. This study aimed to understand whether sdr proteins play a role in biofilm formation by comparing their presence in strong, medium, and weak biofilms.

Understanding the composition of biofilms and the genes/proteins involved in their formation is crucial for breaking down existing biofilms or preventing their development [11].

Further research on the genes contributing to biofilm formation and the variations in biofilm composition among strains is crucial for advancing therapeutic developments, given the current limited understanding of Staphylococcus aureus biofilm structure and growth mechanisms [12]. Our study compared biofilm production by MRSA and MSSA strains isolated from patients and examined the prevalence of sdr genes among S. aureus strains.

2. METHODS AND MATERIALS

2.1. Sample Collection

This study was carried out in the College of Science, University of Anbar, Anbar, Iraq, in 2024. Over a period of approximately 4 months, the period from September, 2023 to January, 2024, 200 samples were collected from patients suffering from various infections suspected of being infected with S. aureus who visited “Fallujah Teaching Hospital, Women and Children's Hospital, Ramadi Teaching Hospital, and Ramadi Hospital for Women and Children”, as well as from patients who were admitted to different hospitals. The sources of these samples were different, including wounds, nasal swabs, blood, and ear swabs.

2.2. Identification of S. aureus Strains and Characterization

The samples were cultured immediately after collection for diagnosis, and S. aureus isolates were identified through cultural tests, microscopic diagnosis, biochemical tests, VITEK system diagnosis, and genetic diagnosis. A combination of tests was used to identify 82 isolates, such as S. aureus. These examinations included growth and fermentation on a selective medium (mannitol salt agar), cell type determination by gram staining, and catalase and coagulase tests for further confirmation. PCR amplification of the nuc gene also verified the isolates as S. aureus. Additionally, cefoxitin susceptibility testing and PCR amplification of the mecA gene were used to identify the isolates as either MRSA or MSSA [13, 14]. The work steps used in this study are shown in Fig. (1).

2.3. Antibiotics Susceptibility Test

The antibiotic susceptibility test was performed following CLSI guidelines 2023 [15]. Various classes of antibiotics were used in the antibiotic susceptibility test, which was carried out on 82 bacterial isolates by the disk diffusion method, as described previously [16]. Fifteen antibiotics (disks) tested against S. aureus were penicillin (10µg), ciprofloxacin (5µg), azethromycin (15µg), chloramphenicol (30µg), tetracycline (10µg), vancomycin (30µg), nitrofurantions (100µg), gentamycin (120µg), oxacillin (10µg), amoxicillin (10µg), doxycyillin (10µg), sulfamethoxazole (25µg), cefixime (5µg), amikacin (30µg), and cefoxitin (30µg) manufactured by Bioanalyse Company (Turkey origin).

2.4. Detection of Biofilm Formation

Biofilm formation was assessed semi-quantitatively using 96-well flat bottom plates, following established methods [17]. Bacterial inoculation was prepared by diluting bacteria in TSB with 1% glucose at a 1:100 ratio. Each well of a 96-well flat-bottomed polystyrene plate received 200 μL of bacterial suspension and then incubated overnight at 37°C. After incubation, plates were washed with PBS and stained with 0.1% crystal violet for 15 minutes at room temperature. Excess stain was removed by washing, and biofilm was quantified by measuring OD570 nm after solubilization in ethanol. Biofilm assays were performed in triplicate, and isolates with OD570 values ≥ the positive control were classified as biofilm-positive.

2.5. Effect of Protease K and DNase on Biofilm Structure

Biofilm composition was analyzed according to the previously described method [18]. After overnight growth in a 96-well plate, the remaining bacterial cells were removed, and wells were washed with PBS. Enzymatic treatments with proteinase K (100 μg/mL in 10Mm Tris-HCl buffer) and DNase (140 μg/mL in TSB) or a mock control were applied for 2 hours at 37°C. After washing, biofilms were fixed, stained, and eluted. OD595 nm was measured to calculate biomass formation inhibition percentage using the following formula:

(Percentage inhibition = 100 - ((OD595 nm experimental well with test material / OD595 nm control well without test material) x 100).

2.6. Extraction of “Extracellular Matrix (ECM)”

Isolates were cultured overnight in TSB at 37°C with shaking (200 rpm). After 16 hr. of incubation, cultures were diluted 1:200 in 50% TSB with 0.5% glucose and transferred 200 μL per well into 96-well plates (triplicate for each isolate). Biofilms formed overnight at 37°C without shaking were washed with distilled water, scraped, and suspended in 50μL of 1X PBS. After centrifuging at 8000 g for 10 minutes, pellets were resuspended in 1.5 M NaCl, centrifuged again at 5000g for 10 minutes, and the supernatant was collected for ECM analysis.

Fig. (1).

The work steps used in this study.

Table 1.
Primers used In the study.
Primer Name Primer Sequence 5′→3 Estimated Product Size (bp) Annealing Temperature (°C) Source
nuc F 5- GCGATTGATGGTGATACGGTT R 5-GCCAAGCCTTGACGAACTAAAGC 270 bp 61(C˚) This study
mecA F 5-TCCAGATTACAACTTCACCAGG R 5- CCACTTCATATCTTGTAACG 162 bp 52(C˚) This study
sdrC F 5- AAAAGGCATGATACCAAATCGA R 5- AATTCTCCATTCGTATGTTCTG 144 bp 55(C˚) This study
sdrD F 5-AGTGGGAACAGCATCAATTTTA R 5-GTGGTAGATTGTACACTTTCTT 272 bp 55(C˚) This study
sdrE F 5-AGAAAGTATACTGTAGGAACTG R 5-GATGGTTTTGTAGTTACATCGT 433 bp 53(C˚) This study
Note: *Tm annealing for each set of primers was determined by PCR troubleshooting to achieve a better result; F, forward; R, reverse.

2.7. Estimation of “Proteins, Polysaccharides, and eDNA Concentrations in ECM”

The extracted ECMs were analyzed for biofilm protein concentration using the Bradford assay, following the method outlined previously [19]. The principle of this assay is that the binding of protein molecules to Coomassie dye under acidic conditions results in a color change from brown to blue. This method measures the presence of the basic amino acid residues, arginine, lysine, and histidine, which contributes to the formation of the protein-dye complex, allowing for relative concentrations of the purified protein to be determined. Polysaccharide concentration was assessed using the phenol-sulfuric acid assay following the method described previously [20]. The phenol-sulfuric acid method is a simple and rapid colorimetric method to determine the total carbohydrates in a sample. This method detected virtually all classes of carbohydrates (mono-, di-, oligo-, and polysaccharides). Results were analyzed by comparing the variation in OD595 units between untreated biofilms and DNase, proteinase K-treated biofilms, correlating with DNA or protein concentrations.

2.8. DNA Extraction

Isolates of S. aureus were grown on mannitol agar for a whole night. Three to four colonies were incubated at 37°C suspended in three milliliters of sterile distilled water. DNA was extracted using the Norgen-Canada Microbiome DNA isolation kit, and DNA was kept at -20°C.

2.9. Detection of sdr Genes

Multiplex PCR was performed to amplify the sdrC, sdrD, and sdrE genes, generating fragments of 144 bp, 272 bp, and 433 bp, respectively [21] (Table 1). PCR mixtures (50 μL) were prepared with 2 mM MgCl2 and 0.5μM each of forward and reverse primers. Moreover, 250μM each of dNTPs, 1.25 U of Taq DNA polymerase, 5 μL of 10X Taq buffer with KCl, and 50 ng of DNA template were also used. Amplification was conducted in a Thermocycler (T100; Biorad, Hercules, CA, USA) with 30 cycles of denaturation at 92°C for 45 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 1 minute, followed by a final extension step at 72°C for 7 minutes [22]. The gene-specific PCR amplicons were visualized using Image Lab Software (Bio-Rad).

2.10. Data Analysis and Statistics

Numerical data were statistically analyzed for significance and presented as Mean ± SD. Significance was determined at the 5% level (p < 0.05) using an F test. Data analysis was conducted using SPSS version 22 software (Supplementary material).

3. RESULTS AND DISCUSSIONS

3.1. Sample Collection and S. aureus Identification

Eighty-two isolates from 200 clinical specimens were diagnosed to be S. aureus based on biochemical testing, cultural and microscopical characteristics, automated Vitek2 system, and molecular identification by the nuc gene, which was collected from the hospitals mentioned in the methods. The main source of isolates was obtained from pus swabs obtained from patients admitted to the burn unit of the government hospital (wound 48 (58.53%), nasal swabs 18 (21.95%), blood 10 (12.19%), and ear swab 6 (7.3%)). All bacterial isolates (100%) with S. aureus were identified molecularly using the nuc gene (Fig. 2). The most frequent isolation from wounds was S. aureus, which was consistent with other earlier reports and other research, particularly those from wealthy countries, that identified S. aureus as the prevalent bacterium [23, 24]. In another study in Iran, S. aureus was found to be a common pathogen in wound infections at a rate of 20.2% [25]. Results of previous studies [26-28] have reported that both S. aureus and P. aeruginosa are the most frequently isolated bacteria in wound injuries. S. aureus is frequently found in wounds because it colonizes human skin and mucous membranes and can be transmitted from hands and nose to wounds. Burn wounds offer an ideal environment for bacterial growth and are more persistent sources of infection compared to surgical wounds, largely due to their larger size and extended hospital stays. Extensive wounds can also lead to immunosuppression [29].

3.2. Antibiotic Susceptibility Profiles

The highest resistance was reported to penicillin (100%), cefoxitin (83%), vancomycin (0%), oxacillin (83%), amoxicillin (76%), azithromycin (61%), tetracycline (26%), doxycycline (34%), sulfamethoxazole (16%), chlor- amphenicol (15%), ciprofloxacin (7%), nitrofurantoin (27%), gentamycin (0%), cefixime (100%), and amikacin (0%) (Fig. 3). Of the isolates, 14 (17%) sensitive isolates and 68 (83%) resistant isolates emerged. Such findings are in agreement with the previous study, which observed that about 86.04% of isolates were MRSA while 13.95% were MSSA [30]. This study found that 100% of the isolates were resistant to penicillin and 83% to oxacillin; both are β-lactam antibiotics that inhibit the production of cell walls. The overuse of these antibiotics may be the cause of this high resistance rate. These findings are consistent with those of a previous investigation [31], which found that S. aureus isolates from clinical hospitals in Cairo had 100% resistance to oxacillin and penicillin, which was also consistent with the results of other studies [32, 33]. For cefoxitin, this resistance is caused by two mechanisms: first, the expression of β-lactamase enzyme that hydrolyzes the β-lactam ring makes the antibiotic inactive, and second, the specific staphylococcal SCCmec (Cassette chromosome mec), which carries gene mecA that encodes for a protein called penicillin-binding protein (PBP2a) and has a poor tendency (affinity) for attaching β-lactams by substituting the endogenous PBP enzyme, which is a target of the antibiotic, makes the synthesis of the cell wall remains active. Moreover, the growth of S. aureus is also not affected due to its resistance to inhibition by β-lactams, thereby making the S. aureus resistant to a vast number of antibiotics belonging to β-lactams (such as cefoxitin) and also penicillin. This explains the cause of multi-antibiotic resistance in these strains. Resistance to these antibiotics occurs by different mechanisms, such as chemical modification, ribosomal protection, and efflux pump [34].

Fig. (2).

PCR identification of S. aureus isolates on the basis of the “nuc gene, which was amplified using the uni-plex PCR method. M(bp): 1.5% agarose, TAE buffer (1x), DNA ladder (100 bp), 70 volts for 1.5 hours”.

Fig. (3).

The percentage of antibiotic susceptibility test of S. aureus isolates. Penicillin (P), Cefoxitin (FOX), Oxacillin (OX), Amoxicillin (AX), Azithromycin (AT), Doxycyillin (DO), Nitrofurantoin (F), Tetracycline (TE), Sulfamethoxazole (SXT), Chloramphenicol (C), Ciprofloxacin (CIP), Gentamycin (HLG), Vancomycin(V), Amikacin (AK).

3.3. Biofilm Formation

Biofilm form of MRSA and MSSA isolates was measured by CV staining after overnight growth. MRSA biofilms are known to be more robust than MSSA biofilms [35, 36]. Biofilm mass showed significant variation in both MRSA and MSSA isolates. The mean OD595 for MSSA isolates was 0.37±0.22. However, the mean OD595 for MRSA isolates (0.78±0.46) was significantly higher, indicating more robust biofilm formation (p = 0.005). Understanding the matrix's organization and development is crucial for effective control strategies. Biofilms from each isolate were tested for exposure to degradation by proteinase K and DNase to determine their protein and eDNA content, respectively. Polysaccharide concen- trations were measured using the phenol sulfuric-acid assay on extracted ECMs. Biofilms of sensitive isolates were not significantly affected by proteinase K treatment, while biofilms of resistant isolates showed a significant reduction. The average reduction in MSSA biofilms (29.67±16.62) was significantly lower than in MRSA biofilms (46.21±26.33) (p=0.032), indicating higher protein content in MRSA biofilms. Protein concentrations from ECMs, estimated using the Bradford assay, showed a significant positive correlation with decreased crystal violet binding after proteinase K dealing (R2=0.0924, significance (p=0.040) (Fig. 4). Most MRSA and MSSA isolates were moderate biofilm producers, which was consistent with the findings of Smith et al. (2008) [37]. Controlling biofilms may focus on dispersing or degrading the extracellular polymeric matrix rather than directly killing the bacteria. MRSA isolates formed more robust biofilms with higher protein content compared to MSSA isolates. These findings are consistent with the results obtained from previous studies [38]. Dakheel et al. (2016) also identified proteinaceous components as key elements of the MRSA biofilm matrix [39]. It has been suggested that MSSA biofilms primarily consist of polysaccharides, whereas MRSA biofilms are composed mainly of DNA and proteins. The results indicated that S. aureus (MRSA) isolates have more protein-based biofilms. When the MRSA isolates were treated with proteinase, there was a high rate of biofilm reduction. This increase in the rate of biofilm reduction indicates a high concentration of proteins in MRSA isolates.

Similar to proteinase K, DNase treatment resulted in varying degrees of biofilm reduction for both MSSA and MRSA isolates (Fig. 5A-B). The average biofilm reduction for MRSA isolates (49.65±25.30) was significantly higher than for MSSA isolates (28.71±20.98) (p = 0.006), indicating that MRSA biofilms generally contain more eDNA. Previous studies have reported that strong biofilm producers of MRSA have higher eDNA levels compared to weak biofilm producers [40]. This indicates that eDNA plays a greater role in MRSA, with strong biofilm producers generally having more eDNA compared to MSSA isolates, which produce weak biofilms. eDNA is a crucial component of biofilm building [41]. DNase I treatment has been reported to block or alter biofilm formation in Gram-positive cells, such as S. aureus, S. pneumonia, and L. monocytogenes [41-43]. According to our data, DNase I significantly affected the dissemination of biofilms in the majority of the tested isolates. This result is in line with the findings reported by Rice et al. [44], who found that the structural stability of S. aureus biofilms relies on eDNA. DNase I-induced eDNA degradation reduces the biofilm [45]. Moreover, it has been found that eDNA not only increased biofilm stability but also its resistance to antibiotics. DNase I can prevent biofilm formation in both PIA-dependent MSSA and PIA-independent MRSA, as well as disperse preformed biofilms [46]. Other studies have focused primarily on protein and polysaccharide composition rather than the eDNA component of biofilms [47]. These results suggest that eDNA is generally necessary for the formation of large biofilms in MRSA. Previous studies reported that some low biofilm producers can have high levels of eDNA, indicating that eDNA quantity does not always correlate with biofilm-forming ability [48]. In contrast, this study reported that isolates MS1, MS3, MS9, MS10, MS11, MS12, MS13 (MSSA), and MR8 (MRSA), which produced weak biofilms, contained small amounts of eDNA. This suggests that eDNA levels correlate with biofilm-forming capacity. Targeting eDNA could be a key strategy for developing eradication methods against S. aureus biofilms.

Fig. (4).

Effect of Proteinase K on biofilm structure in MSSA and MRSA Isolates: (A) Percent reduction in biofilm for MSSA (light color) and MRSA (dark blue) isolates. (B) Average percent reduction in biofilm for MSSA and MRSA isolates (p < 0.05).

Fig. (5).

Effect of DNase on biofilm structure in MSSA and MRSA Isolates: (A) in biofilm for MSSA (light color) and MRSA (dark blue) isolates. (B) Average percent reduction in biofilm for MSSA and MRSA isolates (p < 0.01).

MRSA and MSSA exhibited differing polysaccharide content in their biofilms. MSSA biofilms had a significantly higher average polysaccharide concentration (206.86± 82.92 μM/OD595) compared to MRSA biofilms (85.80±32.52μM/OD595, p=0.005), indicating that MSSA biofilms contain more polysaccharides. O’Gara's group noted that methicillin-sensitive S. aureus (MSSA) typically forms biofilms dependent on PIA, whereas methicillin-resistant S. aureus (MRSA) tends to produce PIA-independent biofilms to a greater extent than MSSA [49].

3.4. Molecular Detection of sdr Genes among S. aureus Clinical Isolates

The serine-aspartate repeat proteins (sdr) are crucial surface proteins in S. aureus, contributing to its pathogenicity. Among 82 S. aureus isolates, 77 (93.90%) tested positive for at least one of the three sdr genes: sdrC (93.90%), sdrD (60.97%), and sdrE (79.26%). Specifically, 69 isolates (84.14%) were positive for two or three sdr genes. Notably, the prevalence of sdrC (100%), sdrD (80%), and sdrE (90%) was highest among blood isolates, followed by wound isolates with sdrC (100%), sdrD (71%), and sdrE (82%) (Table 2, Fig. 6).

Table 2.
Gene biomarkers distribution according to the source of isolation.
- - - Source - -
Bio marker Total positive Wound
(n= 48)
Nasal swab (n= 18) Blood
(n= 10)
Ear swab
(n=6)
nuc 82/82(100%) 48/48(100%) 18/18(100%) 10/10(100%) 6/6(100%)
mecA 68/82(83%) 47/48(98%) 7/18(39%) 10/10(100%) 4/6(67%)
sdrC 77/82(93.90%) 48/48(100%) 14/18(78%) 10/10(100%) 5/6(83%)
sdrD 50/82(60.97%) 34/48(71%) 6/18(33%) 8/10(80%) 2/6(33%)
sdrE 65/82(79.26%) 42/48(88%) 11/18(61%) 9/10(90%) 3/6(50%)
Fig. (6).

PCR products of Sdr genes. L ( Ladder 100-1200 bp), sdrC bands with 144bp, sdrD bands with 272pb, sdrE bands with 433bp.

Fig. (7).

Prevalence of sdr genes among strong, medium, and weak biofilms in MRSA and MSSA of S. aureus isolates. asterisk (*) indicates significance at p < 0.05, (**) indicates significance at p < 0.01 and (ns) not significant.

3.5. Prevalence sdr Genes among S. aureus

Results of the prevalence of sdr genes among MRSA and MSSA isolates are presented in Table 3 and Fig. (7). Molecular detection revealed sdrC as the most prevalent gene (93.90%), followed by sdrE (79.26%) and sdrD (60.97%). Overall, sdr genes were more common in methicillin-resistant than methicillin-sensitive isolates. Notably, sdrC showed a significantly higher presence compared to sdrD and sdrE in both MRSA and MSSA isolates, which was consistent with previous findings [8]. In a previous study, all MRSA isolates were found to be positive for two or three (sdr) genes. Our findings indicate that the simultaneous presence of sdrC, sdrD, and sdrE genes together was higher in MRSA isolates (63.23%) compared to MSSA isolates (7%). Earlier research highlighted a significant association between the presence of the sdrD gene and MRSA isolates [7]. It was observed that the distribution of the SdrD gene was higher in MRSA isolates compared to MSSA isolates, often coexisting with both sdrC and sdrE genes rather than with just one of them. In contrast, the sdrC gene tended to coexist more frequently with sdrE (25%) than with sdrD (7.35%) in MRSA isolates. These findings highlight the prevalence of sdrD and sdrE genes in MRSA, suggesting their involvement in bacterial resistance and as significant virulence factors in resistant strains. A significant difference was observed in isolates between biofilm-strong producing and biofilm-weak producing with respect to the sdrC, sdrD, and sdrE genes. This result is consistent with the findings of several studies on sdrC in Staphylococcus aureus isolates from patients [7, 50, 51], where they observed that SDR genes are highly prevalent in invasive Staphylococcus aureus isolates compared to other types of SDR genes. This may indicate the importance of the protein in bacterial colonization and invasiveness of host tissues. In addition, considering the isolates as a whole, the presence of sdrD and sdrE significantly improved biofilm formation. Our study underscores the roles of sdrC, sdrD, and sdrE proteins in biofilm formation, particularly emphasizing the importance of sdrD in forming robust biofilms.

Table 3.
Prevalence sdr genes among MRSA and MSSA isolates S. Aureus.
- S. aureus
Isolates (n=82) (%)
MRSA
Isolates (n=68) (%)
MSSA Isolates(n=14) (%)
sdrC 77/82 (93.90%) 68/68 (100%) 9/14 (64%)
sdrD 50/82 (60.97%) 48/68 (71%) 2/14 (14%)
sdrE 65/82 (79.26%) 61/68 (90%) 4/14 (36%)
sdrC+, sdrD+ and sdrE+ 44/82 (53.65%) 43/68 (63.23%) 1/14 (7%)
sdrC+, sdrD+ and sdrE− 6/82 (7.31%) 5/68 (7.35%) 1/14 (7%)
sdrC+, sdrD− and sdrE+ 19/82 (23.17%) 18/68 (25%) 1/14 (7%)
sdrC−, sdrD+ and sdrE+ 0 0 0
sdrC+, sdrD− and sdrE− 8/82 (9.75%) 2/68 (3%) 6/14 (42.85%)
sdrC−, sdrD+ and sdrE− 0 0 0
sdrC−, sdrD− and sdrE+ 2/82 (2.43%) 0 2/14 (14%)
sdrC−, sdrD− and sdrE− 5/82 (6%) 0 5/14 (35.71%)
+, positive; -, negative - - -

CONCLUSION

In conclusion, the virulence of S. aureus is largely attributed to its capability to form biofilms, which depends significantly on various proteins that facilitate this process. The estimation of biofilm components was studied, and the focus was on estimating proteins. The prevalence and distribution of the three sdrc genes (sdrC, sdrD, and sdrE) in MSSA and MRSA isolates were studied, and the prevalence in different biofilms (weak, moderate, and strong) was determined. This study reported the highest distribution of sdrC and sdrE genes in different biofilm formations. However, the sdrD gene showed the highest distribution level only in biofilms with high protein concentrations, highlighting the importance of encoded proteins in biofilm structure development and suggesting the role of sdrD in biofilm accumulation. However, further studies are needed to understand the exact role of sdrD in biofilm formation.

AUTHORS’ CONTRIBUTION

R. A. J.: Contributed to the data collection and analysis, writing the theoretical part and participating in the practical part under the full supervision of Professor S. A. L. for all work steps.

LIST OF ABBREVIATIONS

MSCRAMMs = microbial surface components recognizing adhesive matrix molecules
PBP2a = penicillin-binding protein

ETHICS APPROVAL CONSENT TO PARTICIPATE

The study was approved by the Al-Anbar Directorate of Health Ethics and Research Committee, Iraq (approval number 34, decision No. 2022054, dated October 25th, 2023).

HUMAN AND ANIMAL RIGHTS

All human research procedures followed were in accordance with the ethical standards of the committee responsible for human experimentation (institutional and national), and with the Helsinki Declaration of 1975, as revised in 2013.

CONSENT FOR PUBLICATION

Informed consent was obtained from the participants.

AVAILABILITY OF DATA AND MATERIALS

The data supporting the findings of the article is available within the article itself.

STANDARDS OF REPORTING

STROBE guidelines were followed.

FUNDING

Our research is self-funded, with the researchers bearing all costs. We do not receive financial support from our university, city, country, or any external sources.

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

The authors would like to express their gratitude to the laboratory personnel at Fallujah Teaching Hospital and Ramadi Teaching Hospital for their assistance in sample collection.

SUPPLEMENTARY MATERIALS

Supplementary material is available on the Publisher’s website.

REFERENCES

1
Hoseini Alfatemi SM, Motamedifar M, Hadi N, Sedigh Ebrahim Saraie H. Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur J Microbiol 2014; 7(6): e10741.
2
Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005. Emerg Infect Dis 2007; 13(12): 1840-6.
3
Periasamy S, Joo H-S, Duong AC, et al. How Staphylococcus aureus biofilms develop their characteristic structure. Proc Natl Acad Sci USA 2012; 109(4): 1281-6.
4
Stewart PS. Mechanisms of antibiotic resistance in bacterial biofilms. Int J Med Microbiol 2002; 292(2): 107-13.
5
Jamal M, Ahmad W, Andleeb S, et al. Bacterial biofilm and associated infections. J Chin Med Assoc 2018; 81(1): 7-11.
6
Patti JM, Allen BL, McGavin MJ, Höök M. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu Rev Microbiol 1994; 48(1): 585-617.
7
Sabat A, Melles DC, Martirosian G, Grundmann H, van Belkum A, Hryniewicz W. Distribution of the serine-aspartate repeat protein-encoding sdr genes among nasal-carriage and invasive Staphylococcus aureus strains. J Clin Microbiol 2006; 44(3): 1135-8.
8
Peacock SJ, Moore CE, Justice A, et al. Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun 2002; 70(9): 4987-96.
9
Xue H, Lu H, Zhao X. Sequence diversities of serine-aspartate repeat genes among Staphylococcus aureus isolates from different hosts presumably by horizontal gene transfer. PLoS One 2011; 6(5): e20332.
10
Barbu EM, Mackenzie C, Foster TJ, Höök M. SdrC induces staphylococcal biofilm formation through a homophilic interaction. Mol Microbiol 2014; 94(1): 172-85.
11
Brady RA, O’May GA, Leid JG, Prior ML, Costerton JW, Shirtliff ME. Resolution of Staphylococcus aureus biofilm infection using vaccination and antibiotic treatment. Infect Immun 2011; 79(4): 1797-803.
12
Gebreyohannes G, Nyerere A, Bii C, Sbhatu DB. Challenges of intervention, treatment, and antibiotic resistance of biofilm-forming microorganisms. Heliyon 2019; 5(8): e02192.
13
Skov R, Smyth R, Larsen AR, et al. Phenotypic detection of methicillin resistance in Staphylococcus aureus by disk diffusion testing and Etest on Mueller-Hinton agar. J Clin Microbiol 2006; 44(12): 4395-9.
14
Anand KB, Agrawal P, Kumar S, Kapila K. Comparison of cefoxitin disc diffusion test, oxacillin screen agar, and PCR for mecA gene for detection of MRSA. Indian J Med Microbiol 2009; 27(1): 27-9.
15
Humphries R, Bobenchik AM, Hindler JA, Schuetz AN. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100. J Clin Microbiol 2021; 59(12): e0021321.
16
Bauer A W, Kirby W M M, Sherris J C, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966; 45(4): 493-6.
17
Cassat JE, Lee CY, Smeltzer MS. Investigation of biofilm formation in clinical isolates of Staphylococcus aureus. Methods Mol Biol 2007; 391: 127-44.
18
Ball AL, Augenstein ED, Wienclaw TM, et al. Characterization of Staphylococcus aureus biofilms via crystal violet binding and biochemical composition assays of isolates from hospitals, raw meat, and biofilm-associated gene mutants. Microb Pathog 2022; 167(April): 105554.
19
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72(1-2): 248-54.
20
DuBois M, Gilles KA, Hamilton JK, Rebers PA, Smith F. Colorimetric method for determination of sugars and related substances. Anal Chem 1956; 28(3): 350-6.
21
Vasudevan P, Nair MKM, Annamalai T, Venkitanarayanan KS. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet Microbiol 2003; 92(1-2): 179-85.
22
Soge OO, Meschke JS, No DB, Roberts MC. Characterization of methicillin-resistant Staphylococcus aureus and methicillin-resistant coagulase-negative Staphylococcus spp. isolated from US West Coast public marine beaches. J Antimicrob Chemother 2009; 64(6): 1148-55.
23
Taylor GD, Kibsey P, Kirkland T, Burroughs E, Tredget E. Predominance of staphylococcal organisms in infections occurring in a burns intensive care unit. Burns 1992; 18(4): 332-5.
24
Lesseva MI, Hadjiiski OG. Staphylococcal infections in the Sofia Burn centre, Bulgaria. Burns 1996; 22(4): 279-82.
25
Ekrami A, Kalantar E. Bacterial infections in burn patients at a burn hospital in Iran. Indian J Med Res 2007; 126(6): 541-4.
26
Abdulkareem AH, Alalwani AK, Ahmed MM, et al. Impact of solidago virgaurea extract on biofilm formation for ESBL-pseudomonas aeruginosa: An in vitro model study. Pharmaceuticals (Basel) 2023; 16(10): 1383.
27
Al Meani SAL, Al Ani ATA. Molecular screening of adhesion proteins genes in Staphylococcus aureus strains isolated from different clinical infections in baghdad city and identification of their relationship with some virulence factors. Journal of Al-Nahrain University Science 2018; 21(1): 79-89.
28
Al Meani S AL. Ciprofloxacin- and gentamicin-mediated inhibition of Pseudomonas aeruginosa biofilms is enhanced when combined the volatile oil from Eucalyptus camaldulensis. SRP 2020; 11(7): 98-105.
29
Schwacha MG, Chaudry IH. The cellular basis of post-burn immunosuppression: macrophages and mediators. Int J Mol Med 2002; 10(3): 239-43.
30
Kandala NJ, Abdulateef M, Imad N. Genotyping of Staphylococcus aureus isolates based on methicillin-resistance genes and its relatedness to some putative virulence factors. Iraqi J Sci 2017; 58(2A): 626-38.
31
Rushdy AA, Salama MS, Othman AS. Detection of methicillin/oxacillin resistant Staphylococcus aureus isolated from some clinical hospitals in Cairo using Meca/Nuc genes and antibiotic susceptibility profile. Int J Agric Biol 2007; 9(6): 800.
32
Naimi HM, Rasekh H, Noori AZ, Bahaduri MA. Determination of antimicrobial susceptibility patterns in Staphylococcus aureus strains recovered from patients at two main health facilities in Kabul, Afghanistan. BMC Infect Dis 2017; 17(1): 737.
33
Azmi K, Qrei W, Abdeen Z. Screening of genes encoding adhesion factors and biofilm production in methicillin resistant strains of Staphylococcus aureus isolated from Palestinian patients. BMC Genomics 2019; 20(1): 578.
34
Al-Hassnawi HH, Al-Charrakh AH, Al-Khafaj J. Antibiotic resistance patterns of community acquired methicillin resistance Staphylococcus aureus (CA-MRSA) in Al-Hilla/Iraq, Karbala. J Pharm Sci 2013; 4(4): 91-102.
35
Rodríguez-Lázaro D, Alonso-Calleja C, Oniciuc EA, et al. Characterization of biofilms formed by foodborne methicillin-resistant Staphylococcus aureus. Front Microbiol 2018; 9: 3004.
36
Doulgeraki AI, Di Ciccio P, Ianieri A, Nychas GE. Methicillin-resistant food-related Staphylococcus aureus: a review of current knowledge and biofilm formation for future studies and applications. Res Microbiol 2017; 168(1): 1-15.
37
Smith K, Perez A, Ramage G, Lappin D, Gemmell CG, Lang S. Biofilm formation by Scottish clinical isolates of Staphylococcus aureus. J Med Microbiol 2008; 57(Pt 8): 1018-23.
38
Neopane P, Nepal HP, Shrestha R, Uehara O, Abiko Y. In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance. Int J Gen Med 2018; 11: 25-32.
39
Dakheel KH, Abdul Rahim R, Neela VK, Al-Obaidi JR, Hun TG, Yusoff K. Methicillin‐resistant Staphylococcus aureus biofilms and their influence on bacterial adhesion and cohesion. BioMed Res Int 2016; 2016(1): 4708425.
40
Sugimoto S, Sato F, Miyakawa R, et al. Broad impact of extracellular DNA on biofilm formation by clinically isolated Methicillin-resistant and -sensitive strains of Staphylococcus aureus. Sci Rep 2018; 8(1): 2254.
41
Whitchurch C B, Tolker-Nielsen T, Ragas P C, Mattick J S. Extracellular DNA required for bacterial biofilm formation. Science 2002; 295(5559): 1487.
42
Tetz GV, Artemenko NK, Tetz VV. Effect of DNase and antibiotics on biofilm characteristics. Antimicrob Agents Chemother 2009; 53(3): 1204-9.
43
Shahadha Abed N, Kariptaş E, Abed Lateef S. Molecular typing of MDR-K. pneumoniae using ERIC-PCR Technique. RJPT 2022; 15(10): 4677-80.
44
Rice KC, Mann EE, Endres JL, et al. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc Natl Acad Sci USA 2007; 104(19): 8113-8.
45
Mulcahy H, Charron-Mazenod L, Lewenza S. Extracellular DNA chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa biofilms. PLoS Pathog 2008; 4(11): e1000213.
46
Izano EA, Amarante MA, Kher WB, Kaplan JB. Differential roles of poly-N-acetylglucosamine surface polysaccharide and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appl Environ Microbiol 2008; 74(2): 470-6.
47
Parastan R, Kargar M, Solhjoo K, Kafilzadeh F. Staphylococcus aureus biofilms: Structures, antibiotic resistance, inhibition, and vaccines. Gene Rep 2020; 20: 100739.
48
Rohde H, Burandt EC, Siemssen N, et al. Polysaccharide intercellular adhesin or protein factors in biofilm accumulation of Staphylococcus epidermidis and Staphylococcus aureus isolated from prosthetic hip and knee joint infections. Biomaterials 2007; 28(9): 1711-20.
49
O’Neill E, Pozzi C, Houston P, et al. Association between methicillin susceptibility and biofilm regulation in Staphylococcus aureus isolates from device-related infections. J Clin Microbiol 2007; 45(5): 1379-88.
50
Josefsson E, McCrea KW, Eidhin DN, et al. Three new members of the serine-aspartate repeat protein multigene family of Staphylococcus aureus. Microbiology 1998; 144(Pt 12): 3387-95.
51
Liu H, Lv J, Qi X, et al. The carriage of the serine-aspartate repeat protein-encoding sdr genes among Staphylococcus aureus lineages. Braz J Infect Dis 2015; 19(5): 498-502.