Multiplex PCR Assay for the Simultaneous Detection of the Brucella Genus in Human Whole Blood and Serum

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Multiplex PCR Assay for the Simultaneous Detection of the Brucella Genus in Human Whole Blood and Serum

The Open Microbiology Journal • 13 Oct 2020 • RESEARCH ARTICLE • DOI: 10.2174/1874434602014010242

Abstract

Background:

Brucellosis disease is a serious zoonosis worldwide and only 17 countries have been recognized as free of brucellosis. The World Health Organization has reported that the incidence of brucellosis is 500,000 cases in a year. Multiplex polymerase chain reaction (PCR) is an ideal method for the identification of brucellosis. The most common primers for the diagnosis of Brucella include B4/B5 and F4/R2. The advantages of multiplex PCR include targeting multiple sequences at the same time, and multiple results are produced in a single test run which saves time and the reagents simultaneously. The purpose of this investigation was to extend and optimize a multiplex PCR for the identification of genus Brucella from serum and whole blood samples.

Methods:

In this experimental and sectional study, blood samples of 25 suspected patients in the acute phase of brucellosis with serum titers higher than 1:80 were collected. Two pairs of specific primers of B4 and B5 the specific gene was amplified. PCR and Multiplex PCR were performed on blood and serum samples.

Results:

Among 25 blood samples, 15 cases (60%) and 9 cases (36%) and among 25 serum samples, 23 cases (92%) and 13 cases (52%) were positive for B4/B5 and F4/R2 in PCR, respectively. In multiplex PCR, among 25 blood samples, 5 cases (20%) showed both bands, 11 cases (44%) showed band 222bp, 4 cases (16%) showed band 905bp and 5 cases (20%) showed no bands. Among 25 serum samples, 6 cases (24%) showed both bands, 15 cases (60%) showed band 222bp, 3 cases (12%) showed band 905bp and 1 case (4%) showed no bands.

Conclusion:

The results of this study show that this multiplex PCR can be used for the diagnosis of brucellosis with high sensitivity in clinical laboratories routinely and it can serve as an alternative substitution for risky culture method and nonspecific serological methods.

Keywords: Brucella, Multiplex PCR, Whole blood, Serum, Brucellosis, World Health Organization (WHO).

1. INTRODUCTION

Brucellosis disease is a serious zoonosis worldwide and only 17 countries have been recognized as free of brucellosis [1]. The World Health Organization (WHO) has reported that the incidence of brucellosis is 500,000 cases in a year [2-5]. The methods based on polymerase chain reaction (PCR) can compensate the drawbacks of traditional techniques for the identification of Brucella (culturing and serology methods) [6]. PCR reduces the time of identification of the diseases and Multiplex PCR is an ideal method for identification of human brucellosis from different clinical samples, which can simultaneously detect and amplify several genomic sequences in one reaction, thereby saving time and costs [7-9]. Nowadays, this method has useful applications such as identification of different pathogens simultaneously, detection of genetic disorders, and assessing the quantity and quality of samples [9-11]. The most common primers for the identification of genus Brucella with the target of preserved regions in Brucella genome include B4/B5 and F4/R2 [12, 13]. Primer pair B4/B5 amplifies a 223 base pair part of the gene encoding a 31 KD cell surface protein in Brucella abortus (BCSP 31 gene) [5, 12]. Primer pair F4/R2 amplifies a 905 base pair (bp) part of the 16S rRNA gene in Brucella abortus [13-15]. Both primer pairs (B4/B5/ F4/R2) are quite conserved in Brucella spp. and are able to detect almost all Brucella species [14]. Several studies have been performed on the detection of Brucella at the species level and partially at the biovar level utilizing multiplex PCR [8, 16-20]. However, until now, no study with this technique has been performed for the identification of Brucella at the genus level. There are PCR inhibitors in clinical samples that constrain DNA amplification [21, 22]. In whole blood, substances such as ethylenediaminetetraacetic acid (EDTA), sodium citrate or heparin as blood anticoagulants [23], the components of red blood cell lysis and in serum, substances such as proteins and immunoglobulin G are known as inhibitors [21, 23, 24]. As Brucella has the facultative intracellular nature, the bacterial count is low in a patient’s body [25]. The presence of inhibitors in whole blood and serum reduces the sensitivity of primers used in the diagnosis of disease [14, 23, 24]. The purpose of this investigation was to extend and optimize a suitable method for the detection of genus Brucella by multiplex PCR in serum and whole blood samples which have low amounts of DNA and high amounts of inhibitors.

2. MATERIALS AND METHODS

2.1. Sample Collection and Processing

25 blood specimens were obtained from teaching hospital in Nahavand city. Samples were taken from patients with the acute phase of brucellosis which have been referred to a physician with symptoms of brucellosis. Serum was isolated from whole blood samples and stored at -20 ºC for later uses after confirming brucellosis by using serological tests (Wright, 2-mercaptoethanol and coombs wright).

2.2. Isolation of DNA from Clinical Blood and Serum Samples

DNA was extracted from serum samples using boiling method. 200 µl of serum was poured in 1.5 ml tube and then was centrifuged at 15000×g for 15 minute. Supernatant was discarded and 200 µl of DNase and RNase free water was added to sediment, mixed, and centrifuged at 15000×g for 10 minute. Supernatant was discarded and 40 µl of DNase and RNase free water was added to sediment, mixed, and placed in water bath with temperature 95-97 ̊ C for 10 min. Then immediately placed in the freezer (–20 ̊ C) for 2 minutes and finally centrifuged at 15000×g for 10 seconds. DNA was recovered by centrifuging the samples at 15,000 3 g for 10 min; the pellets were rinsed with 1 ml of 70% ethanol, dried, and resuspended in 30 ml of water. Also, DNA was extracted from whole blood specimens utilizing the kit (Denazist Asia Iran). DNA extraction included washing several times with buffers and one step lysis using protease K. The concentration and purity of the DNA were determined spectrophotometrically by reading A260/280.

2.3. Primer Design

Two primer pairs that are broadly used for the detection of genus Brucella were selected. The primer pairs used were B4/B5 and F4/R2 (Table 1). Primers were assessed using bioinformatic software including Basic Local Alignment Search Tool (BLAST), allele ID 7, base stacking TM online and primer premier 5. The strength and weakness points of two primer pairs were evaluated. As F4/R2 has more sensitivity than B4/B5 for the detection of Brucella in pure culture [14], we changed B4/B5 to match the sensitivity of F4/R2. After investigations of factors that cause a negative impact on amplification, sequences B4 and B5 were changed accordingly. Therefore, firstly, the annealing temperature of B4/B5 primer pair was made closer to that of F4/R2 primer pair; secondly, negative factors for amplification were removed as much as possible. Finally, AA in 3ʹ end of B4 and CG in 5ʹ end of B5 were removed. Primer pair B4/B5 with this modification amplifies a 222 bp fragment in the same gene. The primer pairs (10 pmol) were used in PCR and multiplex PCR.

Table 1.
Primers and genes used in PCR and multiplex PCR.
Product Gene Sequence 5ʹ → 3ʹ Primer
222bp BCSP31 TGGCTCGGTTGCCAATATC
CGCTTGCCTTTCAGGTCTG
B4
B5
905bp 16S rRNA TCGAGCGCCCGCAAGGGG
AACCATAGTGTCTCCACTAA
F4
R2

2.4. Amplification and Detection of Brucella DNA by PCR and Multiplex PCR

Multiplex PCR is a widespread molecular biology technique for the amplification of multiple targets in a single PCR experiment. In a multiplexing assay, more than one target sequence can be amplified by using multiple primer pairs in a reaction mixture. As an extension to the practical use of PCR, this technique has the potential considerably save time and effort in the laboratory without compromising the utility of the experiment. Single template PCR is a technique that uses a single template which can be a genomic DNA along with several pairs of forward and reverse primers to amplify specific regions within a template. To prepare the main solution for PCR and multiplex PCR with primers B4/B5 and F4/R2, ingredients were mixed in tubes 0.2 ml DNase free in a total volume of 25 µl. For positive control, DNA isolated by the boiling method from a pure culture of Brucella abortus strain S19 was used. In the negative control, sterile distilled water was used instead of DNA.

PCR and multiplex PCR were performed using two primer pairs on whole blood and serum samples. The conditions for PCR with primers B4/B5 were40 cycles of initial denaturation at 90°C for 5 min, denaturation at 90°C for 60s, annealing at 53°C for 60s and extension at 72°C for 60s and a final extension at 72°C for 10 min. The conditions for PCR with primers F4/R2 were 40 cycles of initial denaturation at 90°C for 5 min, denaturation at 95°C for 30s, annealing at 54°C for 90s and extension at 72°C for 90s, and a final extension at 72°C for 6 min.

The condition for multiplex PCR with primers B4/B5 and F4/R2 was including 40 cycles of initial denaturation 90°C for 5 min, denaturation at 90°C for 60s, annealing at 54°C for 60s and extension at 72°C for 60s, and a final extension at 72°C for 10 min.

Fig. (1). The result of multiplex PCR and single PCR assay for detection of Brucella genus: Lane M: Marker DNA 100 bp, Lane 1: PCR product for B4/B5 and F4/R2, Lane 2: PCR product for B4/B5, Lane 3: PCR product for F4/R2, Lane 4: PCR product for B4/B5 (Positive control), Lane 5: Negative control.

3. RESULTS

Some modifications in the sequences of primers B4/B5 in comparison with the sequences designed by Baily et al [12] were done. The annealing temperature of this primer pair was changed from 56.8 ̊ C to 55.3 ̊C (calculated by the base stacking Tm online) and was more close to the annealing temperature of primer pair F4/R2 (53 ̊ C). With this change, cross dimer was removed and the product rating was increased from 68 to 86. Also, non-specific connections in blast results were reduced greatly. From 25 whole blood samples which were examined by PCR, 15 cases (60%) with primers B4/B5 and 9 cases (36%) with primers F4/R2 were positive. The number of negative whole blood cases with primers B4/B5 was 10 cases (40%) and with primers F4/R2 was 16 cases (64%). From 25 serum samples which were examined by PCR, 23 cases (92%) with primers B4/B5 and 13 cases (52%) with primers F4/R2 were positive. The number of negative serum cases with primers B4/B5 was 2 cases (8%) and with primers F4/R2 was 12 cases (48%) (Table 2). In multiplex PCR with determined programs, bands were observed and results showed that DNA isolation and PCR were performed accurately. The 222 bp and 905 bp bands resulted from experiments with primers B4/B5 and F4/R2, respectively, are shown in Fig. (1). From 25 whole blood samples which were examined by multiplex PCR, 5 cases (20%) showed both bands, 11 cases (44%) showed the band resulted by primers B4/B5 and 4 cases (16%) showed the band resulted by primers F4/R2. In 5 cases (20%), no band was observed. From 25 serum samples which were tested by multiplex PCR, 6 cases (24%) showed both bands, 15 cases (60%) showed the band resulted by primers B4/B5 and 3 cases (12%) showed the band resulted by primers F4/R2. In one case (4%), no band was visible (Table 3).

Table 2.
The results of PCR on whole blood and serum samples.
F4/R2 B4/B5 Number Samples
Negative Positive Negative Positive
16(64%) 9(36%) 10(40%) 15(60%) 25 Whole
blood
12(48%) 13(52%) 2(8%) 23(92%) 25 Serum
Table 3.
The results of multiplex PCR on whole blood and serum samples.
No band B4/B5 and F4/R2 simultaneously F4/R2 only B4/B5 only Number Samples
5(20%) 5(20%) 4(16%) 11(44%) 25 Whole
blood
Multiplex PCR
1(4%) 6(24%) 3(12%) 15(60%) 25 Serum

4. DISCUSSION

In this study, two primer pairs broadly used for the diagnosis of brucellosis were utilized. The goal of this investigation was to optimize a multiplex PCR technique for the identification of Brucella for utilizing in diagnostic laboratories. In the present study, changes were performed on the primers B4/B5 sequences. In a theoretical view, negative amplification factors for primers B4/B5 were reduced and also B4/B5 annealing temperature was closer to F4/R2 primers. In a practical view, this method was able to detect Brucella and bands of both primers were visible using gel electrophoresis. Modified primers B4/B5 with these changes amplified a 222 bp fragment in the same gene [BCSP31 gene]. Queipo-Ortuno et al. found 100% sensitivity in peripheral blood using B4/B5 primer pair amplifying a 223 bp fragment of the bcsp 31 gene [4]. Zerva et al. reported that the sensitivity of primers B4/B5 improved from 61% to 94% when serum was used instead of whole blood samples [5]. Baddour et al. [26] demonstrated that the sensitivity of primers B4/B5 and F4/R2 on peripheral human blood was 98% and 53.1%, respectively. Mitka et al. [27], showed that the sensitivity of primers B4/B5 on the buffy coat, whole blood and serum samples was 100%, 100% and 97%, respectively. Also, a few studies have evaluated the sensitivity of primers in clinical serum samples. It was observed that, in theoretical terms, modified sequences of this primer were more sensitive and more specific than sequences designed by Baily et al. [10], for the diagnosis of brucellosis because, in comparison of BLAST results, new sequences have negative amplification factors lesser than reference sequences. Also, both new sequences have identical annealing temperatures which increased the specificity of this primer pair. In this regard, further research is needed for evaluation and comparison of the new sequences of this primer with reference sequences to clarify which can be more efficient for the diagnosis of brucellosis in practice. Sifuentes-Rincon et al. designed four primers from B. abortus sequences at the well-conserved Omp2 locus and amplified DNA of all six species of Brucella by using these primers [28]. Bricker et al. designed a multiplex method to recognize B. abortus strain S19 and RB51. Three new oligonucleotide primers in this study were added to the five-primer multiplex Brucella AMOS PCR assay [29]. Imaoka et al. [10], designed a combinatorial PCR with four primers to detect 4 main species of Brucella. Primers were prepared from BCSP31 and Omp2 genes. In a study by Hinić et al, a typical PCR with 7 primer pairs was performed to detect Brucella species [30]. Also, Sreevatsan et al. designed a multiplex approach for molecular identification of B. abortus and/or Mycobacterium bovis infection in cattle [31]. Probert et al. designed a Real-Time multiplex PCR method for the detection of Brucella spp., B. abortus, and Brucella melitensis in a single test [32]. In the studies mentioned above, multiplex PCR was performed for the detection of Brucella species using species-specific primers and no multiplex method has been adopted to detect Brucella at the genus level. In the present study, a multiplex PCR was designed to detect Brucella at the genus level. By using whole blood and serum samples, PCR inhibitors affect amplification which decreases the sensitivity of primers. Consequently, for determination of brucellosis from serum and whole blood, utilizing the primers B4/B5 is preferred. Also, for DNA isolation from serum samples boiling technique was used which decreases the quality than kit method, but using the serum instead of whole blood samples is preferred in the diagnosis of Brucella. The total positive cases of PCR for detection of Brucella from whole blood samples by using both primer pairs in 50 experiments was 24 cases (48%) and for serum samples was 36 cases (72%). While the number of positive cases in multiplex PCR for 25 whole blood samples by using both primer pairs was 20 cases (80%) and for 25 serum samples the number of positive cases was 24 cases (96%). Using this method, the problems related to molecular diagnosis of Brucella can be overcome and also detection can be done with maximum sensitivity. In the current study, only two primer pairs were used to detect Brucella. This method is easier and more sensitive than methods mentioned in other studies. If DNA isolation is optimized, the sensitivity of this method will increase for the detection of genus Brucella. Routine diagnosis of brucellosis by PCR assay has not been standardized yet. Therefore, this method can routinely be used for the diagnosis of brucellosis in clinical laboratories and also can be an alternative substitution for risky culture method and nonspecific serological methods.

CONCLUSION

The most cases of brucellosis in Iran are related to species B. abortus and B. melitensis, and primer pairs B4/B5 and F4/R2 have high sensitivity and specificity for these two species (Blast results). Also, using molecular methods in clinical laboratories for the detection of brucellosis has not been optimized; therefore this multiplex PCR can be useful in the diagnosis of brucellosis especially in Iran. This optimization has not been performed earlier and it was the main achievement of our study.

AUTHORS’ CONTRIBUTIONS

HM and MZ designed the study. HM and MZ performed the experiments. HM and EJ performed the data analysis. MZ and HM drafted the manuscript. All authors contributed to the interpretation of the results, provided critical feedback, contributed to the writing of the manuscript and have approved the final version

LIST OF ABBREVIATIONS

WHO  = World Health Organization
PCR  = Polymerase Chain Reaction
EDTA  = Ethylenediaminetetraacetic Acid
BLAST  = Basic Local Alignment Search Tool

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

Not applicable.

HUMAN AND ANIMAL RIGHTS

No animals/humans were used for studies that are the basis of this research.

CONSENT FOR PUBLICATION

Not applicable.

AVAILABILITY OF DATA AND MATERIALS

The authors confirm that the data supporting the findings of this research are available within the article.

FUNDING

This study was partly supported by grant No: 2/27764 from Ferdowsi University of Mashhad, Iran.

CONFLICT OF INTEREST

The author declares no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

Declared none.

REFERENCES

1
Nicoletti P. The epidemiology of bovine brucellosis. Adv Vet Sci Comp Med 1980; 24: 69-98.
2
Havas L. Problems and new developments in the treatment of acute and chronic brucellosis in man. Acta Trop 1980; 37(3): 281-6.
3
Morata P, Queipo-Ortuño MI, Reguera JM, García-Ordoñez MA, Cárdenas A, Colmenero JD. Development and evaluation of a PCR-enzyme-linked immunosorbent assay for diagnosis of human brucellosis. J Clin Microbiol 2003; 41(1): 144-8.
4
Queipo-Ortuño MI, Morata P, Ocón P, Manchado P, Colmenero JD. Rapid diagnosis of human brucellosis by peripheral-blood PCR assay. J Clin Microbiol 1997; 35(11): 2927-30.
5
Zerva L, Bourantas K, Mitka S, Kansouzidou A, Legakis NJ. Serum is the preferred clinical specimen for diagnosis of human brucellosis by PCR. J Clin Microbiol 2001; 39(4): 1661-4.
6
Morata P, Queipo-Ortuño MI, Reguera JM, Miralles F, Lopez-Gonzalez JJ, Colmenero JD. Diagnostic yield of a PCR assay in focal complications of brucellosis. J Clin Microbiol 2001; 39(10): 3743-6.
7
Queipo-Ortuño MI, Colmenero JD, Bermudez P, Bravo MJ, Morata P. Rapid differential diagnosis between extrapulmonary tuberculosis and focal complications of brucellosis using a multiplex real-time PCR assay. PLoS One 2009; 4(2)e4526
8
Yu WL, Nielsen K. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J 2010; 51(4): 306-13.
9
Mirnejad R, Doust RH, Kachuei R, Mortazavi SM, Khoobdel M, Ahamadi A. Simultaneous detection and differentiates of Brucella abortus and Brucella melitensis by combinatorial PCR. Asian Pac J Trop Med 2012; 5(1): 24-8.
10
Imaoka K, Kimura M, Suzuki M, Kamiyama T, Yamada A. Simultaneous detection of the genus Brucella by combinatorial PCR. Jpn J Infect Dis 2007; 60(2-3): 137-9.
11
Kumar S, Tuteja U, Sarika K, Singh D, Kumar A, Kumar O. Rapid multiplex PCR assay for the simultaneous detection of the Brucella Genus, B. abortus, B. melitensis, and B. suis. J Microbiol Biotechnol 2011; 21(1): 89-92.
12
Baily GG, Krahn JB, Drasar BS, Stoker NG. Detection of Brucella melitensis and Brucella abortus by DNA amplification. J Trop Med Hyg 1992; 95(4): 271-5.
13
Romero C, Gamazo C, Pardo M, López-Goñi I. Specific detection of Brucella DNA by PCR. J Clin Microbiol 1995; 33(3): 615-7.
14
Navarro E, Escribano J, Fernández J, Solera J. Comparison of three different PCR methods for detection of Brucella spp in human blood samples. FEMS Immunol Med Microbiol 2002; 34(2): 147-51.
15
Romero C, Pardo M, Grillo MJ, Diaz R, Blasco JM, Lopez-Goñi I. Evaluation of PCR and indirect enzyme-linked immunosorbent assay on milk samples for diagnosis of brucellosis in dairy cattle. J Clin Microbiol 1995; 33(12): 3198-200.
16
Bricker BJ, Halling SM. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J Clin Microbiol 1994; 32(11): 2660-6.
17
Rees RK, Graves M, Caton N, Ely JM, Probert WS. Single tube identification and strain typing of Brucella melitensis by multiplex PCR. J Microbiol Methods 2009; 78(1): 66-70.
18
Ferrão-Beck L, Cardoso R, Muñoz PM, et al. Development of a multiplex PCR assay for polymorphism analysis of Brucella suis biovars causing brucellosis in swine. Vet Microbiol 2006; 115(1-3): 269-77.
19
López-Goñi I, García-Yoldi D, Marín CM, et al. Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol 2008; 46(10): 3484-7.
20
Mayer-Scholl A, Draeger A, Göllner C, Scholz HC, Nöckler K. Advancement of a multiplex PCR for the differentiation of all currently described Brucella species. J Microbiol Methods 2010; 80(1): 112-4.
21
Morata P, Queipo-Ortuño MI, de Dios Colmenero J. Strategy for optimizing DNA amplification in a peripheral blood PCR assay used for diagnosis of human brucellosis. J Clin Microbiol 1998; 36(9): 2443-6.
22
Queipo-Ortuño MI, De Dios Colmenero J, Macias M, Bravo MJ, Morata P. Preparation of bacterial DNA template by boiling and effect of immunoglobulin G as an inhibitor in real-time PCR for serum samples from patients with brucellosis. Clin Vaccine Immunol 2008; 15(2): 293-6.
23
Navarro E, Casao MA, Solera J. Diagnosis of human brucellosis using PCR. Expert Rev Mol Diagn 2004; 4(1): 115-23.
24
Matrone M, Keid LB, Rocha VCM, et al. Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308. Braz J Microbiol 2009; 40(3): 480-9.
25
Gamazo C, Vitas AI, López-Goñi I, Díaz R, Moriyón I. Factors affecting detection of Brucella melitensis by BACTEC NR730, a nonradiometric system for hemocultures. J Clin Microbiol 1993; 31(12): 3200-3.
26
Baddour MM, Alkhalifa DH. Evaluation of three polymerase chain reaction techniques for detection of Brucella DNA in peripheral human blood. Can J Microbiol 2008; 54(5): 352-7.
27
Mitka S, Anetakis C, Souliou E, Diza E, Kansouzidou A. Evaluation of different PCR assays for early detection of acute and relapsing brucellosis in humans in comparison with conventional methods. J Clin Microbiol 2007; 45(4): 1211-8.
28
Sifuentes-Rincón AM, Revol A, Barrera-Saldaña HA. Detection and differentiation of the six Brucella species by polymerase chain reaction. Mol Med 1997; 3(11): 734-9.
29
Bricker BJ, Halling SM. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J Clin Microbiol 1995; 33(6): 1640-2.
30
Hinić V, Brodard I, Thomann A, et al. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems. J Microbiol Methods 2008; 75(2): 375-8.
31
Sreevatsan S, Bookout JB, Ringpis F, et al. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J Clin Microbiol 2000; 38(7): 2602-10.
32
Probert WS, Schrader KN, Khuong NY, Bystrom SL, Graves MH. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J Clin Microbiol 2004; 42(3): 1290-3.