Detection of Plasmid-Mediated qnr Genes Among the Clinical Quinolone-Resistant Escherichia coli Strains Isolated in Tehran, Iran

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Detection of Plasmid-Mediated qnr Genes Among the Clinical Quinolone-Resistant Escherichia coli Strains Isolated in Tehran, Iran

The Open Microbiology Journal • 31 Jul 2018 • RESEARCH ARTICLE • DOI: 10.2174/1874285801812010248

Abstract

Background:

Escherichia coli is one of the most important bacterial agents to cause urinary tract infections. Inappropriate and unnecessary administration of antibiotics has led to an increase in the appearance of multidrug-resistant E. coli isolates, limiting treatment options. The increase in a number of resistant strains of bacteria is a major concern of health authorities worldwide.

Objective:

The purpose of this study was to determine the presence of the qnr genes among E. coli isolated from UTIs of patients in Baqiyatallah hospital in Tehran province, Iran.

Method:

Clinical urine samples of patients with suspected urinary tract infection were collected by standard methods in sterile disposable containers. After analysis of urine, microscopic observations and culture analysis, the bacterial genome was extracted by boiling method. PCR for detection of qnr genes including qnrA, qnrB and qnrS was done by specific primers, then PCR products were run using gel electrophoresis and visualized by gel documentation system.

Results:

In the present study among the 95 isolates, 60 strains were resistant to nalidixic acid. PCR showed that 92 strains were positive for qnrS. The qnrA and qnrB genes were not found among the clinical isolates.

Conclusion:

Our finding indicates a high level of resistance against nalidixic acid among E. coli isolates recovered from the patients with UTI. Also, the high frequency of qnrS imposes the importance of survey of molecular and genetic analysis of mechanisms of quinolone resistance in E. coli strains.

Keywords: Antibiotic resistance, E. coli, qnr, PCR, Clinical strains, UTIs.

1. INTRODUCTION

Escherichia coli (E. coli) is a commonplace bacteria that has been isolated from different sources [1, 2]. E. coli is an important gram-negative bacteria with the potential to cause serious disease such as Urinary Tract Infections (UTIs) [3]. UTIs, which are recognized as the most commonly reported nosocomial infections, account for up to 35% of infections associated with the health-care system, and E. coli bacteria is the most important cause of UTIs [4]. More than thirty patterns for pyelonephritis and cystitis [5] and variety of virulence genes among uropathogenic E. coli strains [6] were obtained. Due to the widespread resistance to other antibiotics, fluoroquinolones that are synthetic and broad-spectrum antibacterial agents often used for the treatment of UTIs in many countries [7-9].

The emergence of various isolates of the drug-resistant E. coli occurs due to the inappropriate and unnecessary administration of these antibiotics and leads to limiting the treatment options. In a recent study, Ranjbar et al. showed highly (96%) antibiotic resistance on clindamycin and frequency of different ESBLs genes among E. coli strains in the surface water sources [10]. Some studies indicated that urine specimens from isolates of different strains of E. coli have high resistance to one or more than one antibiotics [11-13]. Plasmid profile distinguished more strains than the antimicrobial susceptibility pattern [14]. The increase in a number of resistant strains of bacteria is a major concern of health authorities worldwide. Resistance to quinolone is mediated by different routes including mutations in DNA gyrase and topoisomerase subunits [15], decreased outer membrane permeability through porin changes and overexpression of naturally occurring efflux [16]. Moreover, mobile genetic elements, such as plasmids, play a role in quinolone resistance. The plasmid-mediated quinolone resistance is mediated by the genes (qnr) encoding proteins [17]. The major groups of qnr consist of qnrA, qnrB and qnrS [18, 19]. Plasmid-mediated resistance is growing clinical concern due to the transfer of resistance genes through the transfer of the horizontal gene to other species, conferring resistance against these antibiotics [20]. In addition, the presence of Extended-spectrum Beta-lactamases (ESBLs), AmpC, and qnr genes in a plasmid is well documented, indicating the complexity of the determinant factors involved in plasmid resistance among enterobacterial isolates in medical environments [21]. Obviously, the broad emergence of the growing trend associated with the prevalence of plasmid resistance in enterobacterial isolates is undeniable, however, only a limited number of studies of Iran about the prevalence of qnr gene among clinical isolates E. coli has been reported. The purpose of this study was to determine the presence of qnr genes among E. coli isolated from UTIs of patients in Baqiyatallah hospital in Tehran province, Iran.

2. MATERIALS AND METHODS

Over a period of one year, 600 patients that suspected urinary tract infections were examined for E. coli strains. Individual isolates were analyzed by standard biochemical and serological tests as described previously [22]. The slide agglutination test (Mast Diagnostics, Bootle, UK) was used for confirmation of the serogrouping of the isolates. Isolates were stored in trypticase soy broth (Merck KGaA, Darmstadt, Germany) containing 25% glycerol for future tests.

Antimicrobial susceptibility to nalidixic acid and ciprofloxacin was determined by using the disk diffusion method according to the Clinical Laboratory Standards Institute guidelines [23]. Antibiotic discs were placed within a distance of 12 mm from each other and incubated at 37ºC for 18 hrs. E. coli ATCC 25922 was used as quality-control strains to ensure the accuracy of the results obtained by susceptibility testing.

DNA was extracted using the AccuPrep® genomic DNA extraction kit (Bioneer, South Korea) according to the manufacturer’s instructions. The DNA concentration was determined by measuring absorbance of the samples at 260 nm using a spectrophotometer. The PCR and specific primers (Table 1) used for the detection of qnrA, qnrB and qnrS plasmid-mediated quinolone-resistance genes [24]. PCR reaction was performed in a DNA thermocycler as follows: Initial denaturation at 96ºC for 5 min, 30 cycles of denaturation at 95ºC for 1 min, annealing at 55ºC for 1 min (based on the type of primer for each gene is different from that given in Table 1), elongation at 72ºC for 1 min and a final extension step of at 72ºC for 7 min, followed by a hold at 4ºC. PCR products were electrophoresed on 1.5% agarose gel containing ethidium bromide at 80 V for 1 h [25].

Table 1.
Primers used for detection of qnr genes in urinary Escherichia coli isolates.
Primer/target Amplicon Primer Sequence (5´→3´) Size of Product (bp) Annealing Temperature (◦C) Reference
qnrS F: ACGACATTCGTCAACTGCAA 417 53 [38]
R: TAAATTGGCACCCTGTAGGC
qnrA F: ATTTCTCACGCCAGGATTTG 516 53 [38]
R: GATCGGCAAAGGTTAGGTCA
qnrB F: GTTGGEGAAAAAATTGACAGAA 383 53 [39]
R: ACTCCGAATTGGTCAGATCG

3. RESULTS

Totally, 95 E. coli strains were isolated and enrolled in this study. Among the isolates, 60 and 49 strains were resistant to nalidixic acid and ciprofloxacin, respectively. PCR showed that 92 E. coli isolates carried qnrS. The qnrA and qnrB genes were not found among the clinical isolates of this study (Fig. 1).

Fig. (1). PCR amplification of qnrS genes in nalidixic acid-resistant Escherichia coli isolates.

4. DISCUSSION

This study showed a high level of resistance against nalidixic acid among E. coli isolates recovered from the patients with UTI. Among the 95 isolates, 60 strains were resistant to nalidixic acid. Firoozeh et al. [26] showed that 82.5% and 45% of urinary E. coli isolates were resistant to nalidixic acid and ciprofloxacin, respectively. The resistance of E. coli isolates from nosocomial infections was 76% and 52%, to nalidixic acid and ciprofloxacin, respectively in Khorvash et al. study [27]. In China, the prevalence of ciprofloxacin resistance among E. coli isolated from urine was 59.4% [28]. Due to high rates of antibiotic resistance in this study and other studies, a full review of hospital management and further evaluation of monitoring systems are required. This study showed a high prevalence rate of plasmid-mediated quinolone resistance (qnrS). We did not find the qnrA and qnrB genes in our clinical isolates. The frequency of qnrS genes in our study was higher and the frequency of qnrA and qnrB genes in this study that was lower than those found in the two studies previously conducted in Iran. In another study, a low frequency (only a single E. coli isolate among 144 ciprofloxacin-resistant isolates) for qnr gene isolation was also described [29]. In Singapore [30] and Denmark [31], the nalidixic acid-resistant E. coli isolates as qnr positive was 1.8% and 1.6%, respectively. In Canada, only about 1% of E. coli and Klebsiella spp. isolates were resistant to ciprofloxacin and/or tobramycin as qnr positive [32]. Currently, resistance against quinolones and qnr genes has increased in many parts of the world including Iran among Shigella [33], Salmonella [34] and E. coli [35, 36] isolates. Uropathogenic E. coli is the most common cause of urinary tract infections, and quinolones resistant strains cause growing concern in developing countries [37]. Also in a recent study, the low frequency of qnr genes observed among the clinical isolates of E. coli in Iran [40-42]. In this study, qnrS-positive isolates showed high-level resistance, however other mechanisms such as secondary changes in DNA gyrase or topoisomerase IV, and porin or efflux systems, which was not evaluated in our study that could be involved in resistance patterns.

CONCLUSION

In conclusion, our finding showed high frequencies of quinolone resistance genes among E. coli isolated from UTIs of patients in Baqiyatallah hospital in Tehran province, Iran. The circulation of strains of E. coli with a resistance plasmid gene can be considered as a risk for the spread of these types of genes among other bacteria, which requires special considerations. Also, the appropriate use of antibiotics may be useful to limit the potential spread of these resistant genes.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

Not applicable.

HUMAN AND ANIMAL RIGHTS

No animals/humans were used for studies that are the basis of this research.

CONSENT FOR PUBLICATION

Not applicable.

CONFLICT OF INTEREST

The author declares no conflict of interest, financial or otherwise.

ACKNOWLEDGMENTS

We would like to thank from the “Clinical Research Development Center of Baqiyatallah hospital” for their kind cooperation. This study was financially supported in part by “Clinical Research Development Center of Baqiyatallah hospital”

REFERENCES

1
Ranjbar R, Masoudimanesh M, Dehkordi FS, Jonaidi-Jafari N, Rahimi E. Shiga (Vero)-toxin producing Escherichia coli isolated from the hospital foods; virulence factors, o-serogroups and antimicrobial resistance properties. Antimicrob Resist Infect Control 2017; 6: 4.
2
Ranjbar R, Hosseini S, Zahraei-salehi T, Kheiri R, Khamesipour F. Investigation on prevalence of Escherichia coli strains carrying virulence genes ipaH, estA, eaeA and bfpA isolated from different water sources. Asian Pac J Trop Dis 2016; 6(4): 278-83.
3
Jacobsen SM, Stickler DJ, Mobley HL, Shirtliff ME. Complicated catheter-associated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clin Microbiol Rev 2008; 21(1): 26-59.
4
Wilson ML, Gaido L. Laboratory diagnosis of urinary tract infections in adult patients 2004.
5
Anvarinejad M, Farshad Sh, Ranjbar R, Giammanco GM, Alborzi A, Japoni A. Genotypic analysis of E. coli strains isolated from patients with cystitis and pyelonephritis. Iran Red Crescent Med J 2012; 14(7): 408-16.
6
Jahandeh N, Ranjbar R, Behzadi P, Behzadi E. Uropathogenic Escherichia coli virulence genes: Invaluable approaches for designing DNA microarray probes. Cent European J Urol 2015; 68(4): 452-8.
7
Kariuki S, Revathi G, Corkill J, et al. Escherichia coli from community-acquired urinary tract infections resistant to fluoroquinolones and extended-spectrum beta-lactams. J Infect Dev Ctries 2007; 1(3): 257-62.
8
Karlowsky JA, Hoban DJ, Decorby MR, Laing NM, Zhanel GG. Fluoroquinolone-resistant urinary isolates of Escherichia coli from outpatients are frequently multidrug resistant: Results from the North American Urinary Tract Infection Collaborative Alliance-Quinolone Resistance study. Antimicrob Agents Chemother 2006; 50(6): 2251-4.
9
Ambrozic Avgustin J, Keber R, Zerjavic K, Orazem T, Grabnar M. Emergence of the quinolone resistance-mediating gene aac(6′)-Ib-cr in extended-spectrum-beta-lactamase-producing Klebsiella isolates collected in Slovenia between 2000 and 2005. Antimicrob Agents Chemother 2007; 51(11): 4171-3.
10
Ranjbar R, Sami M. Genetic investigation of Beta-Lactam associated antibiotic resistance among Escherichia Coli strains isolated from water sources. Open Microbiol J 2017; 11(1): 203-10.
11
Ranjbar R, Haghi-Ashtiani MT, Jonaidi Jafari N, Abedini M. The prevalence and antimi-crobial susceptibility of bacterial uropathogens isolated from pediatric patients. Iran J Public Health 2009; 38(2): 134-8.
12
Momtaz H, Karimian A, Madani M, et al. Uropathogenic Escherichia coli in Iran: Serogroup distributions, virulence factors and antimicrobial resistance properties. Ann Clin Microbiol Antimicrob 2013; 12: 8.
13
Tajbakhsh E, Khamesipour F, Ranjbar R, Ugwu IC. Prevalence of class 1 and 2 integrons in multi-drug resistant Escherichia coli isolated from aquaculture water in Chaharmahal Va Bakhtiari province, Iran. Ann Clin Microbiol Antimicrob 2015; 14: 37.
14
Farshad S, Ranjbar R, Japoni A, Hosseini M, Anvarinejad M, Mohammadzadegan R. Microbial susceptibility, virulence factors, and plasmid profiles of uropathogenic Escherichia coli strains isolated from children in Jahrom, Iran. Arch Iran Med 2012; 15(5): 312-6.
15
Komp Lindgren P, Karlsson A, Hughes D. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother 2003; 47(10): 3222-32.
16
Fernández L, Hancock RE. Adaptive and mutational resistance: Role of porins and efflux pumps in drug resistance. Clin Microbiol Rev 2012; 25(4): 661-81.
17
Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. Plasmid-mediated quinolone resistance: A multifaceted threat. Clin Microbiol Rev 2009; 22(4): 664-89.
18
Kim HB, Park CH, Kim CJ, Kim EC, Jacoby GA, Hooper DC. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother 2009; 53(2): 639-45.
19
Minarini LA, Poirel L, Cattoir V, Darini AL, Nordmann P. Plasmid-mediated quinolone resistance determinants among enterobacterial isolates from outpatients in Brazil. J Antimicrob Chemother 2008; 62(3): 474-8.
20
Davies J, Davies D. Origins and evolution of antibiotic resistance 2010.
21
Rawat D, Nair D. Extended-spectrum b-lactamases in Gram negative bacteria. J Glob Infect Dis 2010; 2(3): 263-74.
22
Ranjbar R, Memariani M. Multilocus variable-number tandem-repeat analysis for genotyping of Shigella sonnei strains isolated from pediatric patients. Gastroenterol Hepatol Bed Bench 2015; 8(3): 225-32.
23
23 Clinical and Laboratory Standards Institute Performance standards for antimicrobial disk susceptibility tests; approved standard 2010; Document M2-A9 9th ed Wayne, PA: CLSI 2010.
24
Lavilla S, González-López JJ, Sabaté M, et al. Prevalence of qnr genes among extended-spectrum beta-lactamase-producing enterobacterial isolates in Barcelona, Spain. J Antimicrob Chemother 2008; 61(2): 291-5.
25
Khakabimamaghani S, Najafi A, Ranjbar R, Raam M. GelClust: A software tool for gel electrophoresis images analysis and dendrogram generation. Comput Methods Programs Biomed 2013; 111(2): 512-8.
26
Firoozeh F, Zibaei M, Soleimani-Asl Y. Detection of plasmidmediated qnr genes among the quinolone-resistant Escherichia coli isolates in Iran. J Infect Dev Ctries 2014; 14(7): 818-22.
27
Khorvash F, Mostafavizadeh K, Mobasherizadeh S, Behjati M. Susceptibility pattern of E. coli-associated urinary tract infection (UTI): A comparison of spinal cord injury-related and nosocomial UTI. Med Sci Monit 2009; 15(11): CR579-82.
28
Shao HF, Wang WP, Zhang XW, Li ZD. Distribution and resistance trends of pathogens from urinary tract infections and impact on management. Zhonghua Nan Ke Xue 2003; 9(9): 690-692, 696.
29
Pereira AS, Andrade SS, Monteiro J, Sader HS, Pignatari AC, Gales AC. Evaluation of the susceptibility profiles, genetic similarity and presence of qnr gene in Escherichia coli resistant to ciprofloxacin isolated in Brazilian hospitals. Braz J Infect Dis 2007; 11(1): 40-3.
30
Deepak RN, Koh TH, Chan KS. Plasmid-mediated quinolone resistance determinants in urinary isolates of Escherichia coli and Klebsiella pneumoniae in a large Singapore hospital. 2009
31
Cavaco LM, Hansen DS, Friis-Møller A, Aarestrup FM, Hasman H, Frimodt-Møller N. First detection of plasmid-mediated quinolone resistance (qnrA and qnrS) in Escherichia coli strains isolated from humans in Scandinavia. J Antimicrob Chemother 2007; 59(4): 804-5.
32
Pitout JD, Hanson ND, Church DL, Laupland KB. Population-based laboratory surveillance for Escherichia coli producing extended-spectrum beta-lactamases: Importance of community isolates with blaCTX-M genes. Clin Infect Dis 2004; 15(38(12)): 1736-41.
33
Ranjbar R, Behnood V, Memariani H, Najafi A, Moghbeli M, Mammina C. Molecular characterisation of quinolone-resistant Shigella strains isolated in Tehran, Iran. J Glob Antimicrob Resist 2016; 5: 26-30.
34
Malehmir S, Ranjbar R, Harzandi N. The molecular study of antibiotic resistance to quinolones in Salmonella enterica strains isolated in Tehran, Iran. Open Microbiol J 2017; 11: 189-94.
35
Ranjbar R, Farahani O. The prevalence of plasmid-mediated quinolone resistance genes in Escherichia coli isolated from hospital wastewater sources in Tehran, Iran. Iran J Public Health 2017; 46(9): 1285-91.
36
Abdi S, Ranjbar R, Vala MH, Jonaidi N, Bejestany OB, Bejestany FB. Frequency of bla TEM, bla SHV, bla CTX-M, and qnrA among Escherichia coli isolated from urinary tract infection. Arch Clin Infect Dis 2014; 9(1): e18690.
37
Anvarinejad M, Farshad S, Alborzi A, Ranjbar R, Giammanco GM, Japoni A. Integron and genotype patterns of quinolones-resistant uropathogenic Escherichia coli. Afr J Microbiol Res 2011; 5(22): 3765-70.
38
Gay K, Robicsek A, Strahilevitz J, et al. Plasmid-mediated quinolone resistance in non-Typhi serotypes of Salmonella enterica. Clin Infect Dis 2006; 43(3): 297-304.
39
Jacoby GA, Walsh KE, Mills DM, et al. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob Agents Chemother 2006; 50(4): 1178-82.
40
Rezazadeh M, Baghchesaraei H, Peymani A. Plasmid-Mediated Quinolone-Resistance (qnr) Genes in Clinical Isolates of Escherichia coli Collected from Several Hospitals of Qazvin and Zanjan Provinces, Iran. Osong Public Health Res Perspect 2016; 7(5): 307-12.
41
Arjomandzadegan M, Titov L, Farnia P, et al. Molecular detection of fluoroquinolone resistance-associated gyrA mutations in ofloxacin-resistant clinical isolates of Mycobacterium tuberculosis from Iran and Belarus. Int J Mycobacteriol 2016; 5(3): 299-305.
42
Yaghoubi S, Ranjbar R, Soltan Dallal MM, Shirazi MH, Sharifi-Yazdi MK. The frequency of mutations in quinolone resistance-determining regions and plasmid-mediated quinolone resistance in shigella isolates recovered from pediatric patients in Tehran, Iran: An Overlooked Problem. Microb Drug Resist 2017.