Molecular Study of Quinolone Resistance Determining Regions of gyrA Gene and parC Genes in Clinical Isolates of Acintobacter baumannii Resistant to Fluoroquinolone

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Molecular Study of Quinolone Resistance Determining Regions of gyrA Gene and parC Genes in Clinical Isolates of Acintobacter baumannii Resistant to Fluoroquinolone

The Open Microbiology Journal • 30 Apr 2018 • RESEARCH ARTICLE • DOI: 10.2174/1874285801812010116

Abstract

Introduction:

Acinetobacterb aumannii (A. baumannii) is an important pathogen in health care associated infections. Quinolone resistance has emerged in this pathogen.

Aims & Objectives:

The aim of the present study was to determine the presence of mutations of gyrA gene and parC genes by Restriction Fragment Length Polymorphism Polymerase Chain Reaction (RFLP-PCR) among clinical isolates of A. baumanii.

Materials and Methods:

The study was carried out on 140 clinical isolates of A. baumannii. The isolates were subjected to molecular study of mutations of gyrA gene and parC genes by RFLP–PCR beside determination of Minimal Inhibitory Concentration (MIC) by macro dilution tube method.

Results:

The isolates of A. baumannii were resistant to ciprofloxacine and levofloxacin at MIC >4 µg/ml. The most isolates had MIC >128 µg/ml (42.3%). All resistant strains to ciprofloxacin of A. baumannii had mutations in gyrA and parC. The most frequent mutations were combined mutations in both genes (85.5%) and 5% had single mutation either in gyrA or parC. The most frequently combined mutations were associated with MIC >128 µg/ml (42.3%).

Conclusion:

From this study we can conclude that resistance to ciprofloxacin was common in clinical isolates of A. baumannii. The most frequent mutations were present in gyrA and parC. However, mutations in parC alone were not uncommon. Further large scale studies are required to elucidate the resistance pattern of A. baumannii and its molecular mechanisms.

Keywords: A. baumannii, Quinolone resistance, RFLP-PCR, Molecular mechanisms, Clinical isolates, Mutations.

1. INTRODUCTION

Acinetobacter baumannii (A. baumannii) has emerged in the last years as an important pathogen causing health care associated infections. It is one of the so called “ESKAPE” bacteria known to have high antibiotics resistance (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) [1]. A. baumannii is responsible for varieties of serious infections especially among patients in intensive care units such as blood stream infections, ventilator associated pneumonia, wound infections and urinary tract infections [2, 3].

A. baumannii has been associated with several antibiotics resistance not limited to Extended-Spectrum β-Lactamase. There are reports concerning the development of resistance to fluoroquinolones that represents a therapeutic target for this organism [4].

Fluoroquinolones act mainly on bacterial DNA topoisomerases enzymes class II (DNA gyrase) and class I. These enzymes are important for DNA replication in bacterial species. Fluoroquinolones inhibit the action of supercoiling in the bacterial cells mediated by both enzymes and result in impaired DNA replication therefore inhibiting cell division [5, 6].

The main mechanism of resistance to fluoroquinolones is the mutations of the genes that encode the subunits of DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE). The mutations involve mainly the Quinolone Resistance-Determining Regions (QRDRs) of gyrA gene and its homologous region of the parC gene. On the other hand, the mutations in gyrB and parE genes regions are of minor significance [7-9].

There are few data from Egypt on fluoroquinolone resistance among isolates of A. baumanii that involves the mutations in the genes of gyrA and parC genes. Therefore, the aim of the present study was to determine the presence of mutations in gyrA and parC by Restriction Fragment Length Polymorphism Polymerase Chain Reaction (RFLP-PCR) among clinical isolates of A. baumanii.

2. MATERIALS AND METHODS

The study was cross sectional prospective study that was performed in Mansoura University hospitals, Egypt from January 2016 till January 2017. The study included clinical samples from patients admitted to intensive care units (ICUs) with health care associated infections according to the CDC definitions. The study was approved by Mansoura faculty of Medicine ethical committee. Bacterial isolates were recovered from clinical samples according to the standard microbiological culture techniques. Biochemical identification of the A. baumanii isolates was based on Microscan automated system.

Antibiotics susceptibility tests for the isolates was carried out by agar disc diffusion method.

2.1. Antibiotics Discs Susceptibility

Antibiotics susceptibility was performed by disc diffusion method according to the Clinical and Laboratory Standards Institute guidelines [CLSI 2017]. The discs used for antibiotics susceptibility were ampicillin (2µg), ampicillin/sulbactam (10µg+10µg) cefepime (30µg), cefoxitin (30µg), ceftazidime (10µg), ciprofloxacin (1µg), gentamicin (30µg), imipenem (10µg), ceftriaxone (30 µg), meropenem (10 µg), levofloxacin (5μg) and trimethoprim/sulfamethoxazole (1.25/23.75μg), cefotaxime (30µg) (Oxoid).

2.2. Minimal Inhibitory Concentration (MIC) for Ciprofloxacin

Broth macrodilution method was used for the determination of MIC for ciprofloxacin among isolated A. baumanii according to the CLSI instructions. Serial dilutions of ciprofloxacin were prepared using Muller Hinton broth and bacterial isolates with concentration equal to 0.5 McFarland were added to each tube and incubated at 37OC for 18 hours. MIC was defined as the lowest concentration with no visible growth. A. baumannii isolates were considered as intermediate-resistant and full-resistant to ciprofloxacin when the MIC was 2 µg/ml and ≥4 µg/ml, respectively [10].

RFLP -PCR for Detection of Mutations in Gene’s gyrA and parC

2.3. DNA Extraction

Identified isolates of A. baumannii were subjected to DNA extraction by boiling method. Briefly colonies were dissolved in 1ml sterile distilled water and boiled for 10 minutes then centrifuged for another 10 minutes. The supernatant was preserved in sterile eppendorf at -20OC until amplification.

2.4. Amplification Procedures

Amplification procedure was performed by the use of 2 μl of the extracted DNA added to total mixture of 20 μl of amplification mixture supplied by Qiagen. The used primers were summarized in Table 1. The programmed cycles for amplifications were described previously by Villa et al., 1995 and Villa et al., 1999 [7, 8].

Table 1.
Primers sequences of the target genes.
Target Gene Primer sequence (5'-3') Amplicon size
gyrA Forward
AATCTGCCCGTGTCGTTGGT
343 bp
Reverse
GCCATACCTACGGCGATACC
parC Forward
AAACCTGTTCAGCGCCGCATT
327 bp
Reverse
AAAGTTGTCTTGCCATTCACT

Restriction Fragment length Polymorphism for Detection of Mutations in gyrA and parC.

HinfI (Promega) enzyme was used for the digestion of gyrA and parC in the amplified products of A. baumannii. The amplified products were purified by the use of QIA quick PCR purification kit (QIAGEN, Valencia, CA) according to the manufacturer’s protocol. The eluant was incubated at 37°C for 2.5 hours with 10 U of HinfI. The digests were then separated by electrophoresis in 1.5% agarose gel stained with ethidium bromide and photographed with UV illumination. The presence of 291 bp indicated the presence of mutation in gyrA and the presence of 52 bp indicated the presence of mutation in parC.

3. RESULTS

Total 140 isolates of A. baumannii were recovered from clinical isolates from ICUs during one year duration of the study. The majority of the isolates were recovered from wounds culture 60 (42.9%) followed by blood cultures 50 (35.7%) and urine cultures 30 (21.4%), (Table 2).

Table 2.
Distribution of A. baumannii isolates from clinical samples.
Sample No. %
Blood Culture 60 42.9
Wounds Culture 50 37.5
Urine Culture 30 21.4
Total 140 100%

There was a high resistance of the isolated A. baumannii to antibiotics with resistance to ampicillin (100%), ampicillin/sulbactam (100%), imipenem (100%), ceftazidime (99.3%), cefipime (96.4%). Resistance to ciprofloxacin was 92.3%., (Table 3).

Table 3.
Antibiotics Resistance among isolates of A. baumannii.
Antibiotics No. %
Ampicillin 140 100
Ampicillin/sulbactam 140 100
cefepime 135 96.4
cefoxitin 134 95.7
ceftazidime 139 99.3
ciprofloxacin 130 92.9
gentamicin 100 71.4
imipenem 140 100
ceftriaxone 130 92.9
meropenem 140 100
levofloxacin 130 92.9
trimethoprim/sulfamethoxazole 124 88.6
cefotaxime 128 91.4

The isolates of A. baumannii with resistance to ciprofloxacine and levofloxacin had MIC >4 µg/ml. The most isolates had MIC >128 µg/ml (42.3%), (Table 4).

Table 4.
A. baumannii resistance by MIC.
MIC
µg/ml
4
No. %
8
No. %
16
No. %
32
No. %
64
No. %
128
No. %
>128
No. %
gyrA 35 26.9% 30 23.1% 2 1.5% 3 2.3% 2 1.5% 3 2.3% 55 42.3%

All resistant strains of A. baumannii to ciprofloxacin had mutations in gyrA and parC. The most frequent mutations were combined mutations in both genes (85.5%) and 5% had single mutation either in gyrA or parC, (Table 5).

Table 5.
Genetic mutations among A. baumannii isolates.
Characteristics N0. %
gyrA 5 3.6%
parC 5 3.6%
Combined gyrA and parC 120 85.7%
Total 140 100%

The most frequent combined mutations was associated with MIC >128 µg/ml (42.3%), (Table 6).

Table 6.
Distribution of gyrA and parC mutations among resistant A. baumannii in relation to MIC.
Characteristics MIC
µg/ml
4
No. %
8
N0. %
16
N0. %
32
No. %
64
No. %
128
N0. %
>128
N0. %
gyrA 0 0% 0 0% 0 0% 3 2.3% 2 1.5% 0 0% 0 0%
parC 0 0% 0 0% 2 1.5% 0 0% 0 0% 3 23% 0 0%
Combined gyrA and parC 35 26.9% 30 23.1% 0 0% 0 0% 0 0% 0 0% 55 42.3%

4. DISCUSSION

A.baumannii has emerged in last few years as an important pathogen of the health care associated infections. The principle pathogenicity of A.baumannii arises from its wide antibiotic resistance pattern making few options for its therapeutic management among which are flouroquinolone compounds [11].

In the present study A. baumannii was identified by the use of Microscan automated system. Generally, the automated system is an acceptable method for identification of this species compared with other automated and molecular systems such as Vitek 2 and Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS)-based VITEK MS [12].

For antibiotics susceptibility tests antibiotics discs diffusion method was used for screening of the resistance pattern of the isolated A. baumannii species.

All A. baumannii isolates were multidrug resistance according to the definition of Magiorakos & Perl 2008 [11]. Previous report supported the use of quinolone, ceftazidime and impinem as an empirical antibiotics therapy [13]. However, in the present study there was high resistance of the isolated A. baumannii to antibiotics with resistance to ampicillin (100%), ampicillin/sulbactam (100%), imipenem (100%), ceftazidime (99.3%), cefipime (96.4%). This pattern of antibiotics resistance is similar to that reported previously from Egypt on limited number of A. baumannii strains [14]. Therefore, this pattern of resistance limits the available empirical antibiotics therapy used for treating the infections caused by this pathogen. The factors associated with this resistance may be attributed to the overuse of these antibiotics as an empirical therapy with increase of antibiotics resistance through transmission of resistant genes [15]. The remaining therapeutic options are colistin (a relatively toxic drug), tigecycline (a bacteriostatic agent) that has a disadvantage when using in immunocompromised patients [16].

By disc diffusion and MIC the resistance to ciprofloxacin was 92.3%. This is similar to previous study reported in 2017 and more than another study in Egypt, (75%) [17].The resistance of isolated A. baumannii to ciprofloxacine has shown marked increase in the last few years in the developing countries with range from 95% up to 97.7% [3, 18, 19].

In the present study all isolates of A. resistant by disc diffusion method were resistant by MIC method. Similarly, Stone et al., 2007 [20] reported that disc diffusion method was a good rapid screening method to MIC for determination of antibiotics susceptibility.

Resistance of A. baumannii is mediated mainly by mutation in gyrA and parC genes [4, 15, 21, 22].

In the preset study, all resistant A. baumanii isolates to ciprofloxacin had mutations of gyrA gene and/or parC by PCR-RFLP analysis described by previous studies [7, 8].

This method detects the presence of gyrA and parC mutations at codon 83 and codon 80 with substitution of serine with leucine in gyrA and serine with leucine in parC.

The isolates of A. baumanii with MIC to ciprofloxacin more than 128 μg/mL had combined mutations in the gyrA and parC. These findings indicate that combined mutations are associated with high MIC resistance to ciprofloxacin. The combined mutations in these genes are associated with marked decrease in the binding affinity for quinolones in the resistant species [23-27].

The results of our study and the previous study from Egypt [4] suggested that these mutations are common in ciprofloxacin-resistant clinical isolates of A. baumannii and similar findings were reported in previous studies [7, 8, 12, 22, 28]. The study of mechanisms implicated in resistance of A. baumannii to ciprofloxacin should be clarified in different local epidemiological situations.

Though combined mutations of parC and gyrA are reported to be associated with a high-level of resistance to quinolones [8], four clinical isolates in our study had mutations in parC without mutations in gyrA, suggesting that parC may had a primary role in developing resistance to ciprofloxacin without mutation in gyrA. Similar findings were reported by Ardebili et al., 2015 [29].

All the isolates of the A. baumanii resistant to ciprofloxacine were associated with mutations in gyrA and parC. However, other mechanisms can be associated with this resistance such as changes in the efflux systems [30]. Further studies with large number of isolates are required to clarify the mechanisms associated with resistance of A. baumanii.

CONCLUSION

From this study we can conclude that resistance to ciprofloxacin is common in clinical isolates of A. baumannii. The most frequent mutations were those present in gyrA and parC genes. However, mutation in parC alone was not uncommon. Further, large scale studies are required to elucidate the resistance pattern of A. baumannii and its molecular mechanisms.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The study was approved by Mansoura faculty of Medicine ethical committee.

HUMAN AND ANIMAL RIGHTS

Animals did not participate in this research. All human research procedures followed were in accordance with the ethical standards of the committee responsible for human experimentation (institutional and national), and with the Helsinki Declaration of 1975, as revised in 2008.

CONSENT FOR PUBLICATION

Not applicable.

CONFLICT OF INTEREST

The authors declare no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

Decleared none.

REFERENCES

1
Boucher HW, Talbot GH, Bradley JS, et al. Bad bugs, no drugs: no ESKAPE! An update from the infectious diseases society of america. Clin Infect Dis 2009; 48(1): 1-12.
2
Towner KJ, Levi K, Vlassiadi M. Genetic diversity of carbapenem-resistant isolates of Acinetobacter baumannii in Europe. Clin Microbiol Infect 2008; 14(2): 161-7.
3
Ardebili A, Lari AR, Talebi M. Correlation of ciprofloxacin resistance with the AdeABC efflux system in Acinetobacter baumannii clinical isolates. Ann Lab Med 2014; 34(6): 433-8.
4
Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol 2008; 46(8): 2499-507.
5
Champoux JJ. DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 2001; 70: 369-413.
6
Drlica K, Malik M, Kerns RJ, Zhao X. Quinolone-mediated bacterial death. Antimicrob Agents Chemother 2008; 52(2): 385-92.
7
Vila J, Ruiz J, Goñi P, Marcos A, Jimenez de Anta T. Mutation in the gyrA gene of quinolone-resistant clinical isolates of Acinetobacter baumannii. Antimicrob Agents Chemother 1995; 39(5): 1201-3.
8
Vila J, Ruiz J, Goñi P, Jimenez de Anta T. Quinolone-resistance mutations in the topoisomerase IV parC gene of Acinetobacter baumannii. J Antimicrob Chemother 1997; 39(6): 757-62.
9
Sáenz Y, Zarazaga M, Briñas L, Ruiz-Larrea F, Torres C. Mutations in gyrA and parC genes in nalidixic acid-resistant Escherichia coli strains from food products, humans and animals. J Antimicrob Chemother 2003; 51(4): 1001-5.
10
Clinical Laboratory Standards Institute, Wayne; 2013. CLSI Performance standards for antimicrobial susceptibility testing: twentieth informational supplement; pp. M100–S20. CLSI document
11
Maragakis LL, Perl TM. Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin Infect Dis 2008; 46(8): 1254-63.
12
Lee SY, Shin JH, Kim SH, Shin MG, Suh SP, Ryang DW. Evaluation of matrix-assisted laser desorption ionization-time of flight mass spectrometry-based VITEK MS system for the identification of Acinetobacter species from blood cultures: comparison with VITEK 2 and MicroScan systems. Ann Lab Med 2015; 35(1): 62-8.
13
Prashanth K, Badrinath S. In vitro susceptibility pattern of Acinetobacter species to commonly used cephalosporins, quinolones, and aminoglycosides. Indian J Med Microbiol 2004; 22(2): 97-103.
14
Tawfick MM, El-Borhamy MI. PCR-RFLP-Based detection of mutations in the chromosomal fluoroquinolone targets gyrA and parC genes of Acinetobacter baumanii clinical isolates from a tertiary hospital in cairo, egypt. Am J of Microb Res 2017; 5(2): 37-43.
15
Nowroozi J, Akhavan Sepahi A, Tahmasebinejad Kamarposhti L, Razavipour R, Mazhar F. Evaluation of ciprofloxacin (gyrA, parC genes) and tetracycline (tetB gene) Resistance in Nosocomial Acinetobacter baumannii Infections. Jundishapur J Microbiol 2014; 7(2): e8976.
16
Pachón J, Vila J. Treatment of multiresistant Acinetobacter baumannii infections. Curr Opin Investig Drugs 2009; 10(2): 150-6.
17
Gomaa FAZM, Tawakol WM, El-Azm FA. Phenotypic and genotypic detection of some antimicrobial resistance mechanisms among multidrug-resistant Acinetobacter baumannii isolated from immunocompromised patients in Egypt. Egypt J Med Microbiol 2014; 23(4): 99-105.
18
Aly MM, Abu Alsoud NM, Elrobh MS, Al Johani SM, Balkhy HH. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia. Eur J Clin Microbiol Infect Dis 2016; 35(11): 1759-66.
19
Joshi PR, Acharya M, Kakshapati T, Leungtongkam U, Thummeepak R, Sitthisak S. Co-existence ofblaOXA-23andblaNDM-1genes of Acinetobacter baumannii isolated from Nepal: antimicrobial resistance and clinical significance. Antimicrob Resist Infect Control 2017; 6: 21.
20
Stone ND, O’Hara CM, Williams PP, McGowan JE Jr, Tenover FC. Comparison of disk diffusion, VITEK 2, and broth microdilution antimicrobial susceptibility test results for unusual species of Enterobacteriaceae. J Clin Microbiol 2007; 45(2): 340-6.
21
Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother 2003; 51(5): 1109-17.
22
Wisplinghoff H, Decker M, Haefs C, Krut O, Plum G, Seifert H. Mutations in gyrA and parC associated with resistance to fluoroquinolones in epidemiologically defined clinical strains of Acinetobacter baumannii. J Antimicrob Chemother 2003; 51(1): 177-80.
23
Barnard FM, Maxwell A. Interaction between DNA gyrase and quinolones: effects of alanine mutations at GyrA subunit residues Ser(83) and Asp(87). Antimicrob Agents Chemother 2001; 45(7): 1994-2000.
24
Lee JK, Lee YS, Park YK, Kim BS. Mutations in the gyrA and parC genes in ciprofloxacin-resistant clinical isolates of Acinetobacter baumannii in Korea. Microbiol Immunol 2005; 49(7): 647-53.
25
Park S, Lee KM, Yoo YS, et al. Alterations of gyrA, gyrB, and parC and Activity of Efflux Pump in fluoroquinolone-resistant Acinetobacter baumannii. Osong Public Health Res Perspect 2011; 2(3): 164-70.
26
Liu YH, Kuo SC, Lee YT, et al. Amino acid substitutions of quinolone resistance determining regions in GyrA and ParC associated with quinolone resistance in Acinetobacter baumannii and Acinetobacter genomic species 13TU. J Microbiol Immunol Infect 2012; 45(2): 108-12.
27
Redgrave LS, Sutton SB, Webber MA, Piddock LJ. Fluoroquinolone resistance: mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol 2014; 22(8): 438-45.
28
Hamouda A, Amyes SG. Novel gyrA and parC point mutations in two strains of Acinetobacter baumannii resistant to ciprofloxacin. J Antimicrob Chemother 2004; 54(3): 695-6.
29
Ardebili A, Lari AR, Beheshti M, Lari ER. Association between mutations in gyrA and parC genes of Acinetobacter baumannii clinical isolates and ciprofloxacin resistance. Iran J Basic Med Sci 2015; 18(6): 623-6.
30
Ardebili A, Talebi M, Azimi L, Lari AR. Effect of efflux pump inhibitor CCCP on the MIC of ciprofloxacin in Acinetobacter baumannii clinical isolates. Jundishapur J Microbiol 2014; 7(1)