Letter to the Editor: Coinfection of Adenovirus with the Members of Herpesviridae in Ophthalmic Pterygium

All published articles of this journal are available on ScienceDirect.

LETTER

Letter to the Editor: Coinfection of Adenovirus with the Members of Herpesviridae in Ophthalmic Pterygium

The Open Microbiology Journal • 28 Dec 2016 • LETTER • DOI: 10.2174/1874285801610010209

Pterygium is a wing-shaped fibrovascular lesion of the ocular surface that can invade the corneal surface reducing the visual acuity. Its pathogenesis has yet to be fully elucidated [1].

Recent evidence on neoplastic changes of limbal stem cells and molecular genetic abnormalities in pterygium suggested that prolonged exposure to ultraviolet (UV) radiation may promote its development. In addition, the presence of oncogenic viruses including Human papillomavirus (HPV), Cytomegalovirus (CMV), Herpes Simplex Virus (HSV) or Epstein–Barr virus (EBV) in pterygium has been reported by several studies, with prevalences ranging from very low to almost 100% of cases, probably, due to sensitivities in the technologies used, and the DNA template sequences used for Polymerase Chain Reaction (PCR) amplification [1, 2].

Although, HPV-induced formation of lesion is mostly supportive by epidemiological studies for an infectious etiology of pterygium but attempts to detect a specific ” pterygium virus” have not been successful [3].

In this cross-sectional study, 65 confirmed Adenovirus human biopsy specimens of pterygium and 10 normal conjunctivae were conducted to determine the prevalence of CMV, EBV, HSV-1, HSV-2, Human Herpesvirus 6 (HHV-6) and Varicella Zoster Virus (VZV) (Table 1) [3-6].

Tissues from pterygium patients were positive in 8 (12/3%) for CMV, 3 (4/61%) for EBV, 1(1/53%) for HSV-2, 6 (9/23%) for HHV-6 and 1 (1/53%) were positive for VZV. None of the tissues were HSV-1 positive and the viral infection was not detected in any of the negative controls.

The presence of 29/23% herpesviridae family in pterygium, especially unexpected detection of VZV and HHV-6 strongly suggest that limbal stem cells can be considered as one of the sites of the latency of herpesviruses. Although, it seems that other viruses are present, resulting in the disorder which is chronically progressive.

In our previous study, all pterygia samples were positive for Adenoviruses DNA, hypothetically, playing a key role in pterygium, but coinfections Adenovirus with other viruses are reasonable to hypothesize that multiple viral Infections might trigger pterygium-specific events with a synergistic action.

However, reported data shows that our studies is the first and only reported case of Adenovirus-induced formation of pterygium and its association with other viruses. More studies on various geographic regions are needed to clarify the role of Adenoviruses in pterygium formation and possible synergistic effect between viruses in the lesion.

Table 1.
Sequences and positions of primers used for amplification of the viruses.
Virus Region Band size Method Sequence (5' to 3')
HHV-6 the U22 open reading frame 99 bp Real-time PCR 5'- TCGAAATAAGCATTAATAGGCACACT -3'
5'- CGGAGTTAAGGCATTGGTTGA -3'
CMV major capsid protein (MCP) gene 264bp PCR 5'-GAGCGCGTCCACAAAGTCTA-3
5'-GTGATCCGACTGGGCGAAAA-3'
EBV Epstein-Barr nuclear antigen (EBNA) gene 256 bp PCR 5'-AGGGATGCCTGGACACAAGA-3'
5′-GCCTCGGTTGTGACAGAG-3′
HSV-1 Glycoprotein D gene 296 bp PCR 5-CGAAGACGTCCGGAAACAAC-3
5-CGGTGCTCCAGGATAAA-3
HSV-2 Glycoprotein D gene 296 bp PCR 5-GGACGAGGCCCGAAAGCACA-3
5-CGGTGCTCCAGGATAAA-3
VZV Gene 29 264bp PCR 5- ACGGGTCTTGCCGGAGCTGGT-3
5-AATGCCGTGACCACCAAGTATAAT-3

CONFLICT OF INTEREST

The authors confirm that this article content has no conflict of interest.

ACKNOWLEDGEMENTS

The authors thank Laboratory Sciences Research Center, Golestan University of Medical Sciences for the continuous encouragement during this study and the Department of Ophthalmology at Gorgan 5th Azar Medical Center for providing valuable tissue specimen.

This project was supported by Laboratory Sciences Research Center, Golestan University of Medical Sciences (Grant No.921120194). All authors discussed the results and implications and commented on the manuscript at all stages. All authors declare no conflict of interest.

REFERENCES

1
Chalkia AK, Spandidos DA, Detorakis ET. Viral involvement in the pathogenesis and clinical features of ophthalmic pterygium (Review). Int J Mol Med 2013; 32(3): 539-43. [Review].
2
Detorakis ET, Drakonaki EE, Spandidos DA. Molecular genetic alterations and viral presence in ophthalmic pterygium. Int J Mol Med 2000; 6(1): 35-41. [Review].
3
Yavarian J, Gavvami N, Mamishi S. Detection of human herpesvirus 6 in cerebrospinal fluid of children with possible encephalitis. Jundishapur J Microbiol 2014; 7(9): e11821.
4
Kelishadi M, Kelishadi M, Moradi A, Javid N, Bazouri M, Tabarraei A. human adenoviruses role in ophthalmic pterygium formation. Jundishapur J Microbiol 2015; 8(4): e16871.
5
Read SJ, Kurtz JB. Laboratory diagnosis of common viral infections of the central nervous system by using a single multiplex PCR screening assay. J Clin Microbiol 1999; 37(5): 1352-5.
6
Saygun I, Yapar M, Özdemir A, Kubar A, Slots J. Human cytomegalovirus and Epstein-Barr virus type 1 in periodontal abscesses. Oral Microbiol Immunol 2004; 19(2): 83-7.